Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 16, Number 9—September 2010

Research

Worldwide Diversity of Klebsiella pneumoniae That Produce β-Lactamase blaKPC-2 Gene1

Gaëlle Cuzon, Thierry NaasComments to Author , HaVy Truong, Maria-Virginia Villegas, Karin T. Wisell, Yehuda Carmeli, Ana. C. Gales, Shiri Navon-Venezia, John P. Quinn, and Patrice Nordmann
Author affiliations: Author affiliations: Institut National de la Santé et de la Recherche Médicale, Paris, France (G. Cuzon, T. Naas, H. Truong, P. Nordmann); International Center for Medical Research and Training, Cali, Colombia (M.V. Villegas); Swedish Institute for Infectious Disease Control, Stockholm, Sweden (K.T. Wisell); Sourasky Medical Center, Tel Aviv, Israel (Y. Carmeli, S. Navon-Venezia); Universidade Federal de São Paulo, São Paulo, Brazil (A.C. Gales); John H. Stroger Jr. Hospital of Cook County, Chicago, Illinois, USA (J.P. Quinn); Chicago Infectious Disease Research Institute, Chicago (J.P. Quinn)

Main Article

Table 2

Primers used for PCR of Klebsiella pneumoniae isolates producing β-lactamase blaKPC-2 gene*

Primer name Primer no.† Sequence, 5′ → 3′
KpcA 1 CTGTCTTGTCTCTCATGGCC
KpcB 2 CCTCGCTGTGCTTGTCATCC
4281 3 GGCACGGCAAATGACTA
4714 4 GAAGATGCCAAGGTCAATGC
EcoRIout 5 CACCCGACCTGGACGAACTA
3′YCEnd 6 GCATCAAACGGAAGCAAAAG
3781L 7 CACAGCGGCAGCAAGAAAGC
3098U 8 TGACCCTGAGCGGCGAAAGC
905L 9 GCGACCGGTCAGTTCCTTCT
816U 10 CACCTACACCACGACGAACC
141R-6 11 TCACCGGCCCTCACCTTTGG
5′endYC 12 CTTAGCAAATGTGGTGAACG
Pre-SHV-5 U GGTCAGCGCGAGAAGCATCC
Pre-SHV-5 L AAATAGCGTTCATCGTCAAT
Pre-TEM 1 GTATCCGCTCATGAGACAATA
Pre-TEM 2 TCTAAAGTATATATGAGTAAACTTGGTCTG
OXA-9 A TTCGTTTCCGCCACTCTCCC
OXA-9 B ACGAGAATATCCTCTCGTGC
CTX-M A CGCTTTGCGATGTGTCAG
CTX-M B ACC GCG ATA TCG TTG GT

*Primers from (21).
†Numbers correspond to those in Figure 1, panel A. – indicates primer not shown in Figure 1, panel A.

Main Article

1This study was presented in part at the Interscience Conference on Antimicrobial Agents and Chemotherapy; 2009 Sep 12–15; San Francisco, CA, USA.

TOP