Skip directly to search Skip directly to A to Z list Skip directly to site content
CDC Home

Volume 16, Number 9—September 2010

Dispatch

Human Herpesvirus 8 Genotype E in Patients with Kaposi Sarcoma, Peru

Olivier Cassar1, Marie-Lise Blondot1, Salim Mohanna, Gregory Jouvion, Francisco Bravo, Vicente Maco, Renan Duprez, Michel Huerre, Eduardo Gotuzzo, and Antoine GessainComments to Author 
Author affiliations: Author affiliations: Institut Pasteur, Paris, France (O. Cassar, M.-L. Blondot, G. Jouvion, R. Duprez, M. Huerre, A. Gessain); Centre National de la Recherche Scientifique, Paris (O. Cassar, M.-L. Blondot, R. Duprez, A. Gessain); Universidad Peruana Cayetano Heredia, Lima, Peru (S. Mohanna, F. Bravo, V. Maco, E. Gotuzzo)

Main Article

Table A1

Patient and tumor characteristics and results of immunohistochemical analyses and molecular typing of VR1 and VR2 of the open reading frame K1 of HHV-8 in patients with KS, Peru*

ID IP Age, y/sex Origin Lesion No. lesions Biopsy site HIV status Clinical diagnosis Level of spindle cells infiltration Perls CD 34 LANA-1 VR1 PCR†
VR2 PCR
Subtype by molecular analysis
VR1 outer VR1 inner VR2 outer VR2 inner
04/0480 51/M Mestizo Nodule 1 Neck + AIDS KS ++ +++ ++ ++ + E + E + E E
04/0484 29/M Mestizo Nodule Multiple Nose + AIDS KS +++ ++ ++ ++ + C + C C
04/0485 29/M Mestizo Nodule Multiple Head + AIDS KS +++ + ++ ++ + C + C + C C
04/0489 32/M Mestizo Macula 1 Hard palate + AIDS KS ++ ++ ++ + + B + B B
04/0492 34/F Mestizo Macula Multiple Face + AIDS KS +++ +++ ++ ++ + A + A + A A
04/0497 32/M Mestizo Patch Multiple Chest + AIDS KS +++ +++ ++ ++ + C +‡ C
06/0749 35/F Mestizo Macula Multiple Hard palate + AIDS KS + + + + + C + C C
06/0750 35/M Mestizo Macula, nodule Multiple Hard palate + AIDS KS ++ ++ + ++ +‡ C C
06/0758 37/M Mestizo Nodule 1 Eyelid + AIDS KS + ++ ++ +/− + A A
06/0772 24/M Mestizo Papula, nodule Multiple Upper limb + AIDS KS + + + + + E + E + E + E E
04/0479 83/F Mestizo Papula 1 Lower limb Classic KS +++ + + ++ + C + C C
04/0482 75/M Mestizo Nodule Multiple Hand Classic KS +++ +++ ++ ++ +‡ + C + C C
04/0487 70/F Quechua Nodule 1 Foot Classic KS +++ +++ + ++ + C + C C
04/0488 75/M Mestizo Nodule Multiple Foot Classic KS +++ ++ + ++ + C + C C
04/0498 75/M Quechua Nodule 1 Foot Classic KS +++ +++ ++ ++ + A + A + A + A A
06/0733 58/M Mestizo Macula Multiple Hard palate Classic KS - + +/− + C C
06/0739 46/M Mestizo Patch Multiple Upper limb Classic KS + +/− ++ ++ + A + A A
06/0741 30/M Mestizo Nodule 1 Face Classic KS +++ + ++ +++ + A + A + A +‡ A
06/0743 30/M Mestizo Nodule Multiple Face Classic KS ++ ++ + ++ + C + C C
06/0745 31/M Mestizo Papula, nodule Multiple Lower limb Classic KS + + + + + C C
06/0751 26/M Quechua Macula 1 Hard palate Classic KS +++ +++ + ++ + C + C +‡ C
06/0754 63/F Mestizo Nodule Multiple Neck Classic KS ++ +/− +++ +++ + A + A +‡ A
06/0767 76/F Quechua Nodule 1 Lower limb Classic KS +++ + C + C + C C
04/0491 63/F Mestizo Nodule ND Foot ND ++ + + ++ +‡ A +‡ A A
04/0494 75/F ND Nodule ND Foot ND ++ ++ + ++ + A + A A

*KS, Kaposi sarcoma; VR1 and VR2, variable region 1 or 2 of the open reading frame K1 of HHV-8; HHV-8, human herpesvirus 8; ID IP, identification of the specimen given by the Institut Pasteur pathologic unit; LANA, latency-associated nuclear antigen; AIDS KS, KS occurring with HIV-1 infection; –, no amplification product. ND, not determined.
†For VR1, the first PCR was performed with the primer set VR1S (ATCCTTGCCAAYATCCTGGTATTGBAA) / VR1AS1 (ACGATTTGACAGGCGAGACGACAGC) (amplification of 373 bp) and followed by a nested PCR with a second set of primers VR1S/VR1AS2 (ACAATRCAAAGTAACABGCTGRCC) for the amplification of a 220-bp fragment. For VR2 amplification, the first PCR was performed by using the primer set VR2S (TCTCGCCTGTCAAATCBTMTATGT) / VR2AS1(AGTACCAMTCCACTGGTTGYGTAT) amplification of 314 bp and followed by a nested PCR with a second set of primers VR2S/VR2AS2 (AGTTCCTAMGATACCAMACATGGTT) for the amplification of a 240–300-bp fragment. Amplified PCR products of the appropriate size were then purified from gel, cloned, sequenced as previously described (14). Sequences were verified on both DNA strands.
‡Weak PCR signal.

Main Article

1These authors contributed equally to this article.

Top of Page

USA.gov: The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO