Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 17, Number 10—October 2011

Perspective

Global Spread of Carbapenemase-producing Enterobacteriaceae

Patrice NordmannComments to Author , Thierry Naas, and Laurent Poirel

Author affiliation: Bicêtre Hospital, Le Kremlin-Bicêtre, France

Main Article

Table 3

Oligonucleotides used for screening of main carbapenemase genes in Enterobacteriaceae*

Primer Sequence, 5′ → 3′ Gene Product size, bp
IMP-F GGAATAGAGTGGCTTAAYTC blaIMP 232
IMP-R TCGGTTTAAYAAAACAACCACC
VIM-F GATGGTGTTTGGTCGCATA blaVIM 390
VIM-R CGAATGCGCAGCACCAG
OXA-48-F GCGTGGTTAAGGATGAACAC blaOXA-48 438
OXA-48-R CATCAAGTTCAACCCAACCG
NDM-F GGTTTGGCGATCTGGTTTTC blaNDM 621
NDM-R CGGAATGGCTCATCACGATC
KPC-Fm CGTCTAGTTCTGCTGTCTTG blaKPC 798
KPC-Rm CTTGTCATCCTTGTTAGGCG

*A detailed technique for PCR amplification has been reported by Poirel et al. (34). VIM, Verona integron–encoded metallo-β-lactamase; OXA, oxacillinase; NDM, New Delhi metallo-β-lactamase-1; KPC, Klebsiella pneumoniae carbapenemase.

*A detailed technique for PCR amplification has been reported by Poirel et al. (34). VIM, Verona integron–encoded metallo-β-lactamase; OXA, oxacillinase; NDM, New Delhi metallo-β-lactamase-1; KPC, Klebsiella pneumoniae carbapenemase.

*A detailed technique for PCR amplification has been reported by Poirel et al. (34). VIM, Verona integron–encoded metallo-β-lactamase; OXA, oxacillinase; NDM, New Delhi metallo-β-lactamase-1; KPC, Klebsiella pneumoniae carbapenemase.

Main Article

TOP