Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 17, Number 2—February 2011

Research

Arbovirus Prevalence in Mosquitoes, Kenya

A. Desiree LaBeaudComments to Author , Laura J. Sutherland, Samuel Muiruri, Eric M. Muchiri, Laurie R. Gray, Peter A. Zimmerman, Amy G. Hise, and Charles H. King
Author affiliations: Author affiliations: Children’s Hospital Oakland Research Institute, Oakland, California, USA (A.D. LaBeaud); Case Western Reserve University, Cleveland, Ohio, USA (A.D. LaBeaud, L.J. Sutherland, L.R. Gray, P.A. Zimmerman, A.G. Hise, C.H. King); Ministry of Public Health and Sanitation, Nairobi, Kenya (S. Muiruri, E.M. Muchiri)

Main Article

Table 1

Oligonucleotide primer pairs used in assay during Rift Valley fever outbreak, Kenya, 2006–2007*

Target Forward sequence, 5′ → 3′ Reverse sequence, 5′ ← 3′ Product size, bp GenBank accession no.
Mosquito 18S rRNA GATCAAGTGGAGGGCAAGTC AAGGAGTAGCACCCGTGTTG 124 AB085210.1
RVFV TGAAAATTCCTGAGACACATGG ACTTCCTTGCATCATCTGATG 90 DQ375404.1
WNV CAGACCACGCTACGGCG CTAGGGCCGCGTGGG 103 AF196835.2

*RVFV, Rift Valley fever virus; WNV, West Nile virus.

Main Article

1These authors contributed equally to this article.

TOP