Skip directly to search Skip directly to A to Z list Skip directly to site content
CDC Home

Volume 17, Number 2—February 2011

Research

Phocine Distemper Virus in Seals, East Coast, United States, 2006

J.A. Philip Earle, Mary M. Melia, Nadine V. Doherty, Ole Nielsen, and S. Louise CosbyComments to Author 
Author affiliations: Author affiliations: Queen’s University Belfast, Belfast, UK (J.A.P. Earle, M.M. Melia, N.V. Doherty, S.L. Cosby); Department of Fisheries and Oceans Canada, Winnipeg, Manitoba, Canada (O. Nielsen)

Main Article

Table

Phocine distemper virus primers for reverse transcription–PCR and DNA sequencing*

Gene Primer sequence, 5′ → 3′ Gene Primer sequence, 5′ → 3′
P forward ATGTTTATGATCACAGCGGT F4 reverse CCCGTAAACTTGGTCCAA
P reverse ATTGGGTTGCACCACTTGTC F5 forward ATAATATAGGGTCACAGG
M forward ATACTGCATTAACCCTGG F5 reverse CCTGTGACCCTATATTAT
M reverse TTAGGTTGTTGGTCTTGGTAG F6 forward TTGTGCTTCTATCTTGTG
M1 forward ATAACGATGATCTTGGCC F6 reverse CACAAGATAGAAGCACAA
M1 reverse GGCCAAGATCATCGTTAT F7 forward GAATCCTCTGATCAAATC
M2 forward ACACAGCTCAGAGATTCC F7 reverse GATTTGATCAGAGGATTC
M2 reverse GGAATCTCTGAGCTGTGT F8 forward TGCAAGCTGGCACATCAG
M3 forward ACTGGTGTTCGCCCTTGG F8 reverse CTGATGTGCCAGCTTGCA
M3 reverse CCAAGGGCGAACACCAGT H forward CGAGGTTGAGGAAAGAAG
M4 forward TTAAATTCCCAGTTCTTG H reverse CTCAATCTCGGTGGGTAC
M4 reverse CAAGAACTGGGAATTTAA H1 forward AGGCAGTGCATCATCAAG
M5 forward AGCCACTTGAATCTACGG H1 reverse CTTGATGATGCACTGCCT
M5 reverse CCGTAGATTCAAGTGGCT H2 forward CAATCCTCTTGCTGACAC
F forward GAGATTTGTGCACCTTTC H2 reverse GTGTCAGCAAGAGGATTG
F reverse GC ATTGTTCTTGTAAAAGGC H3 forward AGATGGCTAGGTGATATG
F1 forward TCATAGTCTCGATTCACC H3 reverse CATATCACCTAGCCATCT
F1 reverse GGTGAATCGAGACTATGA H4 forward CACCGGGGTTTCATAAAG
F2 forward TTATCAACAATTGGAATC H4 reverse CTTTATGAAACCCCGGTG
F2 reverse GATTCCAATTGTTGATAA H5 forward GGATTATTATGAGGGTAC
F3 forward TGCAGGTGCAGCTCTAGG H5 reverse CAATAGCATGATCACTCC
F3 reverse CCTAGAGCTGCACCTGCA H6 forward GGAGTGATCATGCTATTG
F4 forward TTGGACCAAGTTTACGGG H6 reverse GTACCCTCATAATAATCC

*H, hemagglutinin; P, phosphoprotein; F, fusion; M, matrix.

Main Article

1These authors contributed equally to this article.

Top of Page

USA.gov: The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO