Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 17, Number 2—February 2011

Dispatch

Surveillance for West Nile Virus in Dead Wild Birds, South Korea, 2005–2008

Jung-Yong YehComments to Author , Hyun-Ju Kim, Jin-Ju Nah, Hang Lee, Young-Jun Kim, Jin-San Moon, In-Soo Cho, In-Soo Choi, Chang-Seon Song, and Joong-Bok Lee
Author affiliations: Author affiliations: National Veterinary Research and Quarantine Service, Gyeonggi-do, South Korea (J.-Y. Yeh, H-J. Kim, J.-J. Nah, J.-S. Moon, I.-S. Cho); Seoul National University, Seoul, South Korea (H. Lee, Y.-J. Kim); Konkuk University, Seoul (I.-S. Choi, C.-S.Song, J.-B. Lee)

Main Article

Table

Oligonucleotide primers used for reverse transcription–PCR of West Nile virus in dead wild birds, South Korea, 2005–2008

Primer Sequence, 5’ →3’ Orientation* Genome position† Product size, bp
WN233 TTGTGTTGGCTCTCTTGGCGTTCTT S 233 408
WN640 CAGCCGACAGCACTGGACATTCATA AS 640 408
AmWN1401 ACCAACTACTGTGGAGTC S 1401 445
AmWN1845 TTCCATCTTCACTCTACACT AS 1845 445
AmWN1485 GCCTTCATACACACTAAAG S (nested PCR) 1485 248
AmWN1732 CCAATGCTATCACAGACT AS (nested PCR) 1732 248

*S, sense; AS, antisense.
†Genbank accession no. NC_009942.

Main Article

TOP