Volume 17, Number 4—April 2011
Research
Complete Sequence and Molecular Epidemiology of IncK Epidemic Plasmid Encoding blaCTX-M-14
Table 2
Primers used for detecting pCT-like regions in plasmids from Escherichia coli, United Kingdom, Europe, Australia, and Asia, 2006–2009
| Primer | Sequence, 5′ → 3′ | Target DNA sequence | Size, bp | pCT binding site | Reference |
|---|---|---|---|---|---|
| CTX-M-G9 (F) | ATGGTGACAAAGAGAGTGCAAC | blaCTX-M group 9 variants | 876 | 70259–70280 | (25) |
| CTX-M-G9 (R) | TTACAGCCCTTCGGCGATG | blaCTX-M group 9 variants | 876 | 69405–69423 | (25) |
| ISEcp1A (F) | GCAGGTCTTTTTCTGCTCC | Insertion sequence ISEcp1 | 527 | 71728–71746 | (27) |
| ISEcp1B (R) | ATTTCCGGAGCACCGTTTGC | Insertion sequence ISEcp1 | 527/1,037† | 71220–71239 | (27) |
| B3A (F) | AACGGCACAATGACGCTGGC | Insertion sequence IS903 | 887 | 69913–69932 | (24) |
| IS903 (R) | TGTAATCCGGCAGCGTA | Insertion sequence IS903 | 887 | 69045–69061 | (24) |
| Pseudo (R) | AACATTCGGCCGTTCACAGC | Region downstream of blaCTX-M-14 | 1,636 | 68644–68663 | This study |
| traK (F) | GGTACCGGCATCGCACAGAA | Region upstream of ISEcp1 | 1,037 | 72238–72257 | This study |
| Sigma (F) | ACAGCGTCTTCTCGTATCCA | pCT putative sigma factor | 1,289 | 48590–48609 | This study |
| Sigma (R) | GTTCTTCCAGCTGACGTAAC | pCT putative sigma factor | 1,289 | 47320–47339 | This study |
| pCT rci (F) | AAGGTCATCTGCAGGAGT | pCT shufflon recombinase | 945 | 78364–78381 | This study |
| pCT rci (R) | GTGTGCGCAGCAACAATA | pCT shufflon recombinase | 945 | 77436–77453 | This study |
| pilN (F) | GACAGGCAGAGAACACCAGA | pCT pilN outer membrane protein | 627 | 88267–88286 | This study |
| pilN (R) | ATGCTGTTCCACCTGATGAG | pCT pilN outer membrane protein | 627 | 87659–87678 | This study |
| nikB (F) | CGTGCMTGCCGTGARCTT | IncI complex nikB relaxase gene | 290 | 33077–33094 | This study |
| nikB (R) | TCCCAGCCATCCWTCACC | IncI complex nikB relaxase gene | 290 | 33350–33367 | This study |
| pCT008 (F) | CATTGTATCTATCTTGTGGG | pCT pCT008-pCT009 region | 428 | 3665–3684 | This study |
| pCT009 (R) | GCATTCCAGAAGATGACGTT | pCT pCT008-pCT009 region | 428 | 4074–4093 | This study |
*pCT, IncK plasmid; CTX-M, cefotaximase-modifying; F, forward primer; R, reverse primer.
†Primer ISEcp1B can be paired with primer ISEcp1A (527 bp) or with primer traK (1,037 bp).


