Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 17, Number 4—April 2011

Research

Molecular Epidemiology of Coxiella burnetii from Ruminants in Q Fever Outbreak, the Netherlands

Hendrik I.J. RoestComments to Author , Robin C. Ruuls, Jeroen J.H.C. Tilburg, Marrigje H. Nabuurs-Franssen, Corné H.W. Klaassen, Piet Vellema, René van den Brom, Daan Dercksen, Willem Wouda, Marcel A.H. Spierenburg, Arco N. van der Spek, Rob Buijs, Albert G. de Boer, Peter Th.J. Willemsen, and Fred G. van Zijderveld
Author affiliations: Author affiliations: Central Veterinary Institute, part of Wageningen UR, Lelystad, the Netherlands (H.I.J. Roest, R.C. Ruuls, R. Buijs, A.G. de Boer, P.Th.J. Willemsen, F.G. van Zijderveld); Canisius Wilhelmina Hospital, Nijmegen, the Netherlands (J.J.H.C. Tilburg, M.H. Nabuurs-Franssen, C.H.W. Klaassen); Radboud University Medical Center, Nijmegen (M.H. Nabuurs-Franssen); Animal Health Service, Deventer, the Netherlands (P. Vellema, R. van den Brom, D. Dercksen, W. Wouda); Food and Consumer Product Safety Authority, The Hague, the Netherlands (M.A.H. Spierenburg, A.N. van der Spek)

Main Article

Table 2

Primers and probes used in the PCR for detecting Coxiella burnetii in clinical samples and loci and primers for MLVA of C. burnetii, the Netherlands, 2007–2010*

Identification Temp, °C Primer sequence for MLVA, with label indicated, 5′ → 3′
Forward Reverse
Primers IS1111a 60 CATCACATTGCCGCGTTTAC GGTTGGTCCCTCGACAACAT
Probe IS1111a 60 AATCCCCAACAACACCTCCTTATTCCCAC
Probe inhibition control 60 ACATAATCTCTCCGACCCCACACTTCCATAC
Cbu0448_ms03_12bp_7U_229bp 60 6-FAM-TTGTCGATAAATCGGGAAACTT CACTGGGAAAAGGAGAAAAAGA
Cbu1963_ms21_12bp_6U_210bp 60 NED-AGCATCTGCCTTCTCAAGTTTC TGGGAGGTAGAAGAAAAGATGG
Cbu1980_ms22_11bp_6U_246bp 60 PET-GGGGTTTGAACATAGCAATACC CAATATCTCTTTCTCCCGCATT
Cbu0259_ms24_7bp_27U_344bp 65 VIC-ATGAAGAAAGGATGGAGGGACT GATAGCCTGGACAGAGGACAGT
Cbu0838_ms27_6bp_4U_320bp† 65 6-FAM-GGGTCAGGTGGCGGGTGTG TTCTCGCAAACGTCGCACTAACTC
Cbu0839_ms28_6bp_6U_480bp† 60 VIC-TAGAAACCGATAATCCCCTTGACA ATTCCGCCGCCATTGAG
Cbu1351_ms30_18bp_6U_306bp‡ 60 NED-ATTTCCTCGACATCAACGTCTT AGTCGATTTGGAAACGGATAAA
Cbu1418_ms31_7bp_5U_285bp‡ 60 PET-GGGCATCTAATCGAGATAATGG TTTGAGAAAATTTTGGGTGCTT
Cbu1471_ms34_6bp_5U_210bp 60 6-FAM-TGACTATCAGCGACTCGAAGAA TCGTGCGTTAGTGTGCTTATCT
Cbu1941_ms36_9bp_4U_477bp‡ 65 VIC-GAAACCAGTCTTCCCTCAACAG ATAACCGTCATCGTCACCTTCT

*MLVA, multilocus variable-number tandem-repeat analyses; temp, annealing temperature.
†Different primer set from the proposed set by Arricau-Bouvery et al. (11).
‡Updated after personal communication with Le Flèche, Université Paris-Sud, Orsay Cedex, France.

Main Article

TOP