Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 17, Number 5—May 2011

Dispatch

Genomic Characterization of Nipah Virus, West Bengal, India

Vidya A. ArankalleComments to Author , Bhaswati T. Bandyopadhyay, Ashwini Y. Ramdasi, Ramesh Jadi, Dilip R. Patil, Mehebubar Rahman, Monalisa Majumdar, Parthasarthi S. Banerjee, Amiyakumar K. Hati, Ramaprasad P. Goswami, Dhruba Kumar Neogi, and Akhilesh C. Mishra
Author affiliations: Author affiliations: National Institute of Virology, Pune, India (V.A. Arankalle, A.Y. Ramdasi, R. Jadi, D.R. Patil, A.C. Mishra); Calcutta School of Tropical Medicine, Kolkata, India (B.T. Bandyopadhyay, M. Rahman, M. Majumdar, P.S. Banerjee, R.P. Goswami, D.K. Neogi); Gautam Laboratories, Kolkata (A.K. Hati)

Main Article

Table A1

Primers used for full genome amplification and sequencing of Nipah virus in an interfamilial outbreak, West Bengal, India, 2007

Region Forward primer, 5′ → 3′ Reverse primer, 5′ → 3′
Leader sequence and nucleocapsid protein
F1 1–ACCAAACAAGGGAAAATATGGAT-23 R1 287-CTCGGCTGCACTCGGAGATCTGAT-310
F2 17–TATG GATACGTTAA AATATAT-37 R2 590-TGATAACTGCAGAGACCAGAGT-611
F3 507–TCAA GACTGCTCGG GACAGCAG-528 R3 1115-TCAATAGTAGTAGCCACACCCAT-1137
F4 999–GC TTGATGCTAC TCTACAGAG-1019 R4 1595-TGATTGCTGGGTCATCTGTTGCATT-1619
F5 1479-T GACAGTGTGC CGAGCAGTTCTGT-1503 R5 2115-TAAGAGGTATTGTATACTCCAGT-2137
F6 1999-CA CACTACACTC TAATAAAGAT-2020
Phosphoprotein
F7 2551-TGCAGTGCAC CAGTGGAGAA TCT-2573 R6 2594-CACCTCCATCATCCTTAGAC-2613
F8 3017-TTCT CCTGTGATTG CTGAACACT-3039 R7 3081-TCCAAATTGACATTTCTGTTAGT-3103
F9 3528-GAT AAGACTGAGATCACCAGCGA T-3551 R8 3627-CAGATGGATATTTCTCGTCTGT-3648
F10 4054-CTTGAGTC TATTGACAGG GTTCT-4075 R9 4176-TCACTGGTTTAAGCTCAGGATT-4197
F11 4576-TCTTC TACATGTAGA CAGTAG-4596
R10 4692-TCATGCTACATACACTTCAAT-4712
Matrix protein
F12 5125-GAGCAT TTCAAGTGAG TCT-5143 R11 5181-TTATCAAGATACCCACCATTCT-5202
F13 5586-TTGAT CAGATACAGC TCGAC-5605 R12 5662-TAGTTCGTGGAATCATGTAGATT-5684
F14 6091-GCCTTCTGTT CCGAGAGAGT T-6111
R13 6123-TGTATTGTCAATGAAGACATCAT-6145
Fusion protein
F15 6621-GTTGGTAGAC CTATCAATCA TAT-6643 R14 6713-CACTGCACTCCGAGATCATC-6732
F16 7105-GCAGCA TAGAATCAAC TAATG-7125 R15 7161-GCGGTCAGTACATAGACTGT-7180
F17 7522-TCCAACAGG CCTATATCCA AG-7542 R16 7570-TGCTGATCCATTCTGAATTGT-7590
F18 8078-GCT CAACGACTCCTTGATACTGT T-8110 R17 8130-TACAGTATGATCATAGACAACAT-8152
F19 8638-TGTACTTGCAATT ATACATTGT-8659
Attachment protein
F20 9121-GATCCATTGT AATCATAGTG-9140 R18 8723-TATCCAATGAGTTATGGACCT-8743
F21 9630-T ACTTTGCATA TAGCCACCTG-9650 R19 9202-TGCTGGATACTCTGCAATGCAT-9223
F22 10099-TC GCAGAGTGTC AATACAGCAA ACCT-10124 R20 9698-TGTCTAGTACCTCTCCAACTCCT-9720
F23 10531-GCAACCAGAC CGCAGAGAAT CCT-10553 R21 10149-TATAATGACTGTTTGGTCTAAT-10170
F24 11062-TCAGAGTTA ACAGTCTATA CAT-11083
R22 10561-TACTTCATTATCTTTGAATACAG-10583
R23 11104-CATTGATTGTCATCACTATGC-11124
Large polymerase protein
F25 11668-TGC ATATTGCGTA CCCTGAATGT-11690 R24 11724-TGTTATCAAGTTTGCTAGTCAT-11745
F26 12151-GGATGATGAT GGAGACAACA AT-12172 R25 12200-GAGGGCATTGGACCTCGAGATT-12221
F27 12681-GCACATGCAT CTAAGCATAT-12700 R26 12738-TTCCCAGTTCTTGACACAATCATC-12761
F28 13221-TCAGTTCCTC GTGGAAACAG TC-13241 R27 13252-TATATTATTGATGGATTGAGGAT-13274
F29 13776-GATGA TATATTCATT CATTATCCT-13779 R28 13859-TCTCATAGGCACTCAAGAAT13878
F30 14244-TCAAGGA ATGTCGGCTA TTGTAT-14266 R29 14287-TCAGTTGATATAAGGAGTTGCT-14308
F31 14728-TAG CTAGCTTCCT GATGGACAGG-14750 R30 14770-TTGTCCAGTATCTCATGAGCGG-14791
F32 15241-GTACAGATGA GAGATCAGAT AT-15262 R31 15304-TACTGTCGCAATCCTGATAGCAG-15326
F33 15791-TGATCCAGAT CCTGTTTCAG-15810 R32 15872-TGAAGCTCCTCAGTTGACCAT-15892
F34 16381-CTGTGATTAA CCTACGAGAG GATAT-16405 R33 16461-TTCAGATCTATTATCCAAGGAGG-16483
F35 17038-CAGGTCAGAGAGA ACTGAAGCT-17059 R34 17064-TCAGCAATCGAGTATTCGGATGG-17086
F36 17371-TCTCAAGATT ATTTAACATG T-17391 R35 17429-TAGAATCTGGGTTGCTATACACT-17451
F37 17831-TTCACATCAT TTGGAACCGT AT-17852
Trailer sequence R36 18230-ACCGAACAAGGGTAAAGAAGAAT-18252

Main Article

TOP