Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 17, Number 5—May 2011


Tick-Borne Encephalitis Virus, Kyrgyzstan

Benjamin J. BriggsComments to Author , Barry Atkinson, Donna M. Czechowski, Peter A. Larsen, Heather N. Meeks, Juan P. Carrera, Ryan M. Duplechin, Roger Hewson, Asankadyr T. Junushov, Olga N. Gavrilova, Irena Breininger, Carleton J. Phillips, Robert J. Baker, and John Hay
Author affiliations: Author affiliations: State University of New York, Buffalo, New York, USA (B.J. Briggs, D.M. Czechowski, J. Hay); Health Protection Agency, Porton Down, Salisbury, UK (B. Atkinson, R. Hewson); Texas Tech University, Lubbock, Texas, USA (P.A. Larsen, H.N. Meeks, J.P. Carrera, R.M. Duplechin, C.J. Phillips, R.J. Baker); National Academy of Sciences of the Kyrgyz Republic, Bishkek, Kyrgyz Republic (A.T. Junushov); Ministry of Healthcare of the Kyrgyz Republic, Bishkek (O.N. Gavrilova, I. Breininger)

Main Article

Table 2

Primers used to test rodents, insectivores, and ticks for tick-borne encephalitis virus, Kyrgyzstan, 2007 and 2009*

Primer Gene Sequence, 5′ → 3′ Reference
RH TBE forward E GGCAGCATTGTGACCTGTGT R. Hewson, unpub. data
RH TBE reverse E CGTGTCCTGTGGCTTTCTTTTT R. Hewson, unpub. data
RH TBE probe E 6FAM-AGGYGKCYTGTGAGGC-MGB NFQ R. Hewson, unpub. data

*TBEV, tick-borne encephalitis virus; NS, nonstructural protein; E, envelope.

Main Article