Skip directly to search Skip directly to A to Z list Skip directly to site content
CDC Home

Volume 17, Number 5—May 2011

Letter

Yersinia pestis DNA Sequences in Late Medieval Skeletal Finds, Bavaria

Thi-Nguyen-Ny Tran, Didier Raoult, and Michel Drancourt
Author affiliations: Author affiliation: Université de la Méditerranée, Marseille, France

Main Article

Table

Alignment of pPCP1 Yersinis pestis modern and ancient sequences

Source and Y. pestis strain GenBank
accession no. Sequence, 5′ → 3′
Complete sequence
Y. pestis CO92 plasmid pPCP1 AL109969.1 8488_TATATTTTCAAGAAAAGCTGGCTATTTAACATAACGGCAATTTTTGTACGCACCACTGAA_8547
Y. pestis KIM plasmid pPCP1 AF053945.1 8488_TATATTTTCAAGAAAAGCTGGCTATTTAACATAACGGCAATTT..GTACGCACCACTGAAAT_8547
Y. pestis biovar Microtus str. 91001 plasmid pPCP1 AE017046.1 8487_TATATTTTCAAGAAAAGCTGGCTATTTAACATAACGGCAATTT..GTACGCACCACTGAAAT_8546
Y. pestis Nepal516 plasmid pPCP CP000307.1 9650_TATATTTTCAAGAAAAGCTGGCTATTTAACATAACGGCAATTT..GTACGCACCACTGAAAT_9709
Y. pestis Antiqua plasmid pPCP CP000310.1 9661_TATATTTTCAAGAAAAGCTGGCTATTTAACATAACGGCAATTT..GTACGCACCACTGAAAT_9720
Y. pestis D182038 plasmid pPCP1 CP001592.1 8486_TATATTTTCAAGAAAAGCTGGCTATTTAACATAACGGCAATTT..GTACGCACCACTGAAAT_8545
Y. pestis Z176003 plasmid pPCP1
CP001596.1
8487_TATATTTTCAAGAAAAGCTGGCTATTTAACATAACGGCAATTT..GTACGCACCACTGAAAT_8546
Modern isolate
103813 Y. pestis Nairobi rattus Antiqua HQ542863 61_TATATTTTCAAGAAAAGCTGGCTATTTAACATAACGGCAATTT..GTACGCACCACTGAAAT_120
103814 Y. pestis JHUPRI Antiqua HQ542864 61_TATATTTTCAAGAAAAGCTGGCTATTTAACATAACGGCAATTT..GTACGCACCACTGAAAT_120
103815 Y. pestis 14–47 Medievalis HQ542865 61_TATATTTTCAAGAAAAGCTGGCTATTTAACATAACGGCAATTT..GTACGCACCACTGAAAT_120
103817 Y. pestis 5G5 Medievalis HQ542866 61_TATATTTTCAAGAAAAGCTGGCTATTTAACATAACGGCAATTT..GTACGCACCACTGAAAT_120
103818 Y. pestis 5F1 Medievalis HQ542867 61_TATATTTTCAAGAAAAGCTGGCTATTTAACATAACGGCAATTT..GTACGCACCACTGAAAT_120
103819 Y. pestis 6B4 Medievalis HQ542868 61_TATATTTTCAAGAAAAGCTGGCTATTTAACATAACGGCAATTT..GTACGCACCACTGAAAT_120
103820 Y. pestis 8B7 Medievalis HQ542869 61_TATATTTTCAAGAAAAGCTGGCTATTTAACATAACGGCAATTT..GTACGCACCACTGAAAT_120
103821 Y. pestis 9F11 Medievalis HQ542870 61_TATATTTTCAAGAAAAGCTGGCTATTTAACATAACGGCAATTT..GTACGCACCACTGAAAT_120
103822 Y. pestis 6/69M Orientalis HQ542871 61_TATATTTTCAAGAAAAGCTGGCTATTTAACATAACGGCAATTT..GTACGCACCACTGAAAT_120
103823 Y. pestis EV-76 Orientalis HQ542872 61_TATATTTTCAAGAAAAGCTGGCTATTTAACATAACGGCAATTT..GTACGCACCAC_114
103824 Y. pestis algeria 1 Orientalis HQ542873 64_TATATTTTCAAGAAAAGCTGGCTATTTAACATAACGGCAATTT..GTACGCACCACTGAAA_123
103825 Y. pestis algeria 2 Orientalis
HQ542874
61_TATATTTTCAAGAAAAGCTGGCTATTTAACATAACGGCAATTT..GTACGCACCACTGAAAT_120
Ancient strain detected from teeth
Tooth no. 107 (excavated from Lariey site, France,
17th century) HQ542875 62_TATATTTTCAAGAAAAGCTGGCTATTTAACATAACGGCAATTT..GTACGCACCACTGAAATGC_123
Tooth no. 515 (excavated from Venice site, Italy,
14th–16th centuries) HQ542876 60_TATATTTTCAAGAAAAGCTGGCTATTTAACATAACGGCAATTT..GTACGCACCACTGAAATGC_121
Tooth no.1183 (excavated from Bondy site, France,
11th–15th centuries) HQ542877 62_TATATTTTCAAGAAAAGCTGGCTATTTAACATAACGGCAATTT..GTACGCACCACTGAAAT_121
Tooth no. 1184 (excavated from Bondy site, France,
11th–15th centuries) HQ542878 61_TATATTTTCAAGAAAAGCTGGCTATTTAACATAACGGCAATTT..GTACGCACCACTGAAAT_121
Tooth no. 1190 (excavated from Bondy site, France,
11th–15th centuries) HQ542879 61_TATATTTTCAAGAAAAGCTGGCTATTTAACATAACGGCAATTT..GTACGCACCACTGAAAT_120
Tooth no. 254 (excavated from Venice site, Italy,
14th–16th centuries) HQ542880 61_TATATTTTCAAGAAAAGCTGGCTATTTAACATAACGGCAATTT..GTACGCACCACTGAAAT_120
Tooth no. 1180 (excavated from Bondy site, France,
11th–15th centuries) HQ542881 61_TATATTTTCAAGAAAAGCTGGCTATTTAACATAACGGCAATTT..GTACGCACCACTGAAAT_120

Main Article

Top of Page

USA.gov: The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO