Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 17, Number 5—May 2011

Dispatch

Rickettsia parkeri in Gulf Coast Ticks, Southeastern Virginia, USA

Chelsea L. Wright, Robyn M. Nadolny, Ju Jiang, Allen L. Richards, Daniel E. Sonenshine, Holly D. Gaff, and Wayne L. HynesComments to Author 
Author affiliations: Author affiliations: Old Dominion University, Norfolk, Virginia, USA (C.L. Wright, R. Nadolny, D.E. Sonenshine, H.D. Gaff, W.L. Hynes); Naval Medical Research Center, Silver Spring, Maryland, USA (J. Jiang, A.L. Richards)

Main Article

Table 1

Sequences of primers and probes used to test for Rickettsia spp. DNA in Amblyomma maculatum ticks collected from southeastern Virginia, April–September 2010*

Name Sequence, 5′ → 3′ Gene Fragment Reference
Rpa129F CAAATGTTGCAGTTCCTCTAAATG ompB 96 J. Jiang et al., unpub. data
Rpa224R AAAACAAACCGTTAAAACTACCG ompB 96 J. Jiang et al., unpub. data
Rpa188Probe
6-FAM-CGCGAAATTAATACCCTTATGAGCAGCAGTCGCG-BHQ-1
ompB
96
J. Jiang et al., unpub. data
R17K128F2 GGGCGGTATGAAYAAACAAG 17-kDa antigen gene 111 J. Jiang et al., unpub. data
R17K238R CCTACACCTACTCCVACAAG 17-kDa antigen gene 111 J. Jiang et al., unpub. data
R17K202TaqP
FAM-CCGAATTGAGAACCAAGTAATGC-TAMRA
17-kDa antigen gene
111
J. Jiang et al., unpub. data
190-FN1 AAGCAATACAACAAGGTC ompA 540 (1)
190-RN1
TGACAGTTATTATACCTC
ompA
540
(1)
RompB11F ACCATAGTAGCMAGTTTTGCAG ompB 1895 (9)
RompB1902R CCGTCATTTCCAATAACTAACTC ompB 1895 (9)

*omp, outer membrane protein gene.

Main Article

TOP