Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 17, Number 6—June 2011

Dispatch

Multidrug-Resistant Acinetobacter baumannii Harboring OXA-24 Carbapenemase, Spain

Joshi Acosta, María Merino, Esther Viedma, Margarita Poza, Francisca Sanz, Joaquín R. Otero, Fernando Chaves, and Germán BouComments to Author 
Author affiliations: Author affiliations: Hospital Universitario 12 de Octubre, Madrid, Spain (J. Acosta, E. Viedma, F. Sanz, J.R. Otero, F. Chaves); Complejo Hospitalario Universitario La Coruña, La Coruña, Spain (M. Merino, M. Poza, G. Bou)

Main Article

Table 2

Oligonucleotides used in real-time reverse transcription PCRs for Acinetobacter baumannii, Spain*

Primer Gene Sequence, 5′ → 3′
TonB-Forw TonB-dependent receptor GGACTGGTGATAAAGCACTAT
TonB-Rev TonB-dependent receptor GCCGCATAGAGTTATCACATC
Septicolysin-Forw Septicolysin CACCATCTTGTACCAATACATTT
Septicolysin-Rev Septicolysin GAAATTAGCAGAAGCTCTCTTAC
rpoB-Forw RNA polymerase subunit B CAGCCGCGAYCAGGTTGACTACA
rpoB-Rev RNA polymerase subunit B GACGCACCGCAGGATACCACCTG
gyrB-Forw DNA gyrase subunit B AAGTGAGGTAAAACCAGCGGTA
gyrB-Rev DNA gyrase subunit B AATCTTGCCTGCAATTGATTTT

*Forw, forward; rev, reverse.

Main Article

1These authors contributed equally to this article.

TOP