Skip directly to search Skip directly to A to Z list Skip directly to site content
CDC Home

Volume 17, Number 7—July 2011

Research

Asian Lineage of Peste des Petits Ruminants Virus, Africa

Olivier Kwiatek, Yahia Hassan Ali, Intisar Kamil Saeed, Abdelmelik Ibrahim Khalafalla, Osama Ishag Mohamed, Ali Abu Obeida, Magdi Badawi Abdelrahman, Halima Mohamed Osman, Khalid Mohamed Taha, Zakia Abbas, Mehdi El Harrak, Youssef Lhor, Adama Diallo, Renaud Lancelot, Emmanuel Albina, and Geneviève LibeauComments to Author 
Author affiliations: Author affiliations: Control of Exotic and Emerging Animal Diseases, Montpellier, France (O. Kwiatek, R. Lancelot, E. Albina, G. Libeau); Central Veterinary Research Laboratories, Soba, Sudan (Y.H. Ali, I.K. Saeed, M.B. Abdelrahman, H.M. Osman, Z. Abbas); University of Khartoum, Shambat, Sudan (A.I. Khalafalla, A.A. Obeida); Rabak Veterinary Research Laboratory, White Nile State, Sudan (O.I. Mohamed); Atbara Veterinary Research Laboratory, River Nile State, Sudan (K.M. Taha); Biopharama, Rabat, Morocco (M. El Harrak, Y. Lhor); International Atomic Energy Agency, Vienna, Austria (A. Diallo)

Main Article

Table 3

Multiple sequence alignment of F1/F2 primers and FPPRrev target sites from different PPRV isolates of lineage II compared with isolates of lineage IV*

PPRV isolate† F1 (primer 5′), nt 777–801 F2 (primer 3′), nt 1124–1148 FPPRrev (primer 3′), nt 2055–2079
NIGERIA 75_1‡ ATCACAGTGTTAAAGCCTGTAGAGG GCTTGTAGGTCACAAACTCAGTCTC TCCCTAGGGCTTGTCACATTAATAT
NIGERIA 76_1 ------------------------- ---G--------------------- -------------------------
ICV 89 ------------------------- ------------------------- -------------------------
SUNGRI 96 ------------------------- ---G-----------G---G-C--- -------------------------
China/TibetGeg07-30 --------------A---------- ---G-----C-----G---G-C--- -------------------------
TURKEY 00 ------------------------- ---G-----------G---G-C--- -------------------------

*FPPRrev, new reverse primer designed in this study; PPRV, peste des petits ruminants virus. Nucleotide position (numbered according to GenBank accession no. X74443 sequence). The consensus sequence corresponds to the F gene of the PPRV Nigeria 75_1 vaccine strain. F1/F2 primers from (8).
†Lineage and GenBank accession nos.: NIGERIA 75_1, lineage II, X74443; NIGERIA 76_1, lineage II, EU267274; ICV 89, lineage I, EU267273; SUNGRI 96, lineage IV, AY560591, China/TibetGeg07-30, lineage IV, FJ905304; TURKEY 00, lineage IV, AJ849636.
‡Vaccine strain.

Main Article

Top of Page

USA.gov: The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO