Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 17, Number 7—July 2011

Dispatch

Clonal Genotype of Geomyces destructans among Bats with White Nose Syndrome, New York, USA

Sunanda S. Rajkumar, Xiaojiang Li, Robert J. Rudd, Joseph C. Okoniewski, Jianping Xu, Sudha Chaturvedi, and Vishnu ChaturvediComments to Author 
Author affiliations: Author affiliations: New York State Department of Health, Albany, New York, USA (S.S. Rajkumar, X. Li, R.J. Rudd, S. Chaturvedi, V. Chaturvedi); New York State Department of Environmental Conservation, Albany (J.C. Okoniewski); McMaster University, Hamilton, Ontario, Canada (J. Xu); State University of New York at Albany, Albany (S. Chaturvedi, V. Chaturvedi)

Main Article

Table 2

Geomyces destructans and G. pannorum target gene fragments used for multiple gene genealogic analyses, New York, USA

Gene* Homology (GenBank accession no.) Amplicon size/ sequence used for comparison, bp Primer sequence, 5′ → 3′† G. destructans/G. pannorum GenBank accession nos.
ALR
Penicillium marneffei (XP_002152078.1)
654/534
V1905 (f): CGGAGTGAGATTTATGACGGC HQ834314–HQ834329/HQ834330
V1904 (r): CGTCCATCCCAGACGTTCATC
Bpntase
Glomerella graminicola (EFQ33509.1)
921/745
V1869 (f): TCAGACGGACTCGGAGGGCAAG HQ834331–HQ834346/HQ834347
V1926 (r): TCGGTTACAGAGCCTCAGTCG
DHC1
Sordaria macrospora (CBI53717.1)
597/418
V1906 (f): GGATGATTCGGTCACCAAACAG HQ834348–HQ834363/HQ834364
V1907 (r): ACAGCAAACACAGCGCTGCAAG
GPHN
Ajellomyces capsulatus (EEH06836.1)
659/525
V1918 (f): CACTATTACATCGCCAGGCTC HQ834365–HQ834380/HQ834381
V1919 (r): CTAAACGCAGGCACTGCCTC
PCS
A. capsulatus
(EEH08767.1)
920/749
V1929 (f): AGGCTGCGATTGCTGAGTGC HQ834382–HQ834397/HQ834398
V1873 (r): CCTTATCCAGCTTTCCTTGGTC
POB3
Pyrenophora tritici-repentis (XP_001937502.1)
653/417
V1908 (f): CACAGTGGAGCAAGGCATCC HQ834399–HQ834414/HQ834415
V1909 (r): ACATACCTAGGCGTCAAGTGC
SRP72
A. dermatitidis (EEQ90678.1)
941/640
V1927 (f): AAGGGAAGGTTGGAGAGACTC HQ834416–HQ834431/HQ834432
V1895 (r): CAAGCAGCATTGTACGCCGTC
VPS13 Verticillium albo-atrum (XP_003001174.1) 665/545 V1922 (f): GAGACAACGCTTGTTTGCAAGG HQ834433–HQ834448/HQ834449
V1923 (r): ACATGCGTCGTTCCAAGATCTG

*Genes: ALR, α-L-rhamnosidase; Bpntase, 3′(2′),5′-bisphosphate nucleotidase; DHC1, Dynein heavy chain; GPHN, Gephyrin, molybdenum cofactor biosynthesis protein; PCS, peroxisomal-coenzyme A synthetase; POB3, FACT complex subunit; SRP72, signal recognition particle protein 72; VPS13, vacuolar protein sorting-associated protein.
†f, forward; r, reverse.

Main Article

TOP