Skip directly to search Skip directly to A to Z list Skip directly to site content
CDC Home

Volume 17, Number 7—July 2011


Clonal Genotype of Geomyces destructans among Bats with White Nose Syndrome, New York, USA

Sunanda S. Rajkumar, Xiaojiang Li, Robert J. Rudd, Joseph C. Okoniewski, Jianping Xu, Sudha Chaturvedi, and Vishnu ChaturvediComments to Author 
Author affiliations: Author affiliations: New York State Department of Health, Albany, New York, USA (S.S. Rajkumar, X. Li, R.J. Rudd, S. Chaturvedi, V. Chaturvedi); New York State Department of Environmental Conservation, Albany (J.C. Okoniewski); McMaster University, Hamilton, Ontario, Canada (J. Xu); State University of New York at Albany, Albany (S. Chaturvedi, V. Chaturvedi)

Main Article

Table 2

Geomyces destructans and G. pannorum target gene fragments used for multiple gene genealogic analyses, New York, USA

Gene* Homology (GenBank accession no.) Amplicon size/ sequence used for comparison, bp Primer sequence, 5′ → 3′† G. destructans/G. pannorum GenBank accession nos.
Penicillium marneffei (XP_002152078.1)
V1905 (f): CGGAGTGAGATTTATGACGGC HQ834314–HQ834329/HQ834330
Glomerella graminicola (EFQ33509.1)
V1869 (f): TCAGACGGACTCGGAGGGCAAG HQ834331–HQ834346/HQ834347
Sordaria macrospora (CBI53717.1)
V1906 (f): GGATGATTCGGTCACCAAACAG HQ834348–HQ834363/HQ834364
Ajellomyces capsulatus (EEH06836.1)
V1918 (f): CACTATTACATCGCCAGGCTC HQ834365–HQ834380/HQ834381
A. capsulatus
V1929 (f): AGGCTGCGATTGCTGAGTGC HQ834382–HQ834397/HQ834398
Pyrenophora tritici-repentis (XP_001937502.1)
V1908 (f): CACAGTGGAGCAAGGCATCC HQ834399–HQ834414/HQ834415
A. dermatitidis (EEQ90678.1)
V1927 (f): AAGGGAAGGTTGGAGAGACTC HQ834416–HQ834431/HQ834432
VPS13 Verticillium albo-atrum (XP_003001174.1) 665/545 V1922 (f): GAGACAACGCTTGTTTGCAAGG HQ834433–HQ834448/HQ834449

*Genes: ALR, α-L-rhamnosidase; Bpntase, 3′(2′),5′-bisphosphate nucleotidase; DHC1, Dynein heavy chain; GPHN, Gephyrin, molybdenum cofactor biosynthesis protein; PCS, peroxisomal-coenzyme A synthetase; POB3, FACT complex subunit; SRP72, signal recognition particle protein 72; VPS13, vacuolar protein sorting-associated protein.
†f, forward; r, reverse.

Main Article

Top of Page The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO