Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 18, Number 10—October 2012

Research

WU and KI Polyomaviruses in Respiratory Samples from Allogeneic Hematopoietic Cell Transplant Recipients

Jane Kuypers1Comments to Author , Angela P. Campbell1, Katherine A. Guthrie, Nancy L. Wright, Janet A. Englund, Lawrence Corey, and Michael Boeckh
Author affiliations: University of Washington, Seattle, Washington, USA (J. Kuypers, A.P. Campbell, N.L. Wright, J.A. Englund, L. Corey, M. Boeckh); Fred Hutchinson Cancer Research Center, Seattle (J. Kuypers, A.P. Campbell, K.A. Guthrie, J.A. Englund, L. Corey, M. Boeckh); and Seattle Children’s Hospital, Seattle (A.P. Campbell, J.A. Englund)

Main Article

Table 1

Primers and probes used for detecting KIPyV, WUPyV, and 2 other viruses by real-time RT-PCR and PCR in HCT recipients*

Virus Target gene Amplicon size, bp Function Sequence/label, 5′→3′ PCR concentration, nmol/L
KIPyV VP2–3 74 Forward primer CTATCCCTGAATACCAGTTGGAAAC 425
Reverse primer GTATGACGCGACAAGGTTGAAG 425
Probe FAM-TTCCGGGCATCCCAGACTGGC-BHQ1 125
WUPyV VP1 75 Forward primer AACCAGGAAGGTCACCAAGAAG 300
Reverse primer TCTACCCCTCCTTTTCTGACTTGT 300
Probe HEX-CAACCCACAAGAGTGCAAAGCCTTCC-BHQ1 75
Influenza B Matrix 76 Forward primer CACAATTGCCTACCTGCTTTCA 250
Reverse primer CCAACAGTGTAATTTTTCTGCTAGTTCT 250
Probe VIC-CTTTGCCTTCTCCATCTT-MGBNFQ 100
Parainfluenza type 4 NP 94 Forward primer TGCCAAATCGGCAATAAACA 250
Reverse primer GGCTCTGGCAGCAATCATAAG 250
Probe VIC-TGATTCTGCATTGATGTGG-MGBNFQ 100

*KIPyV, KI polyomavirus; WUPyV, WU polyomavirus; RT-PCR, reverse transcription PCR; HCT, hematopoietic cell transplantation; VP, viral protein; NP, nucleoprotein.

Main Article

1These authors contributed equally to this article.

TOP