Skip directly to search Skip directly to A to Z list Skip directly to site content
CDC Home

Volume 18, Number 11—November 2012

Research

Epidemic Myalgia in Adults Associated with Human Parechovirus Type 3 Infection, Yamagata, Japan, 2008

Katsumi MizutaComments to Author , Makoto Kuroda, Masayuki Kurimura, Yoshikazu Yahata, Tsuyoshi Sekizuka, Yoko Aoki, Tatsuya Ikeda, Chieko Abiko, Masahiro Noda, Hirokazu Kimura, Tetsuya Mizutani1, Takeo Kato, Toru Kawanami, and Tadayuki Ahiko
Author affiliations: Yamagata Prefectural Institute of Public Health, Yamagata, Japan (K. Mizuta, Y. Aoki, T. Ikeda, C. Abiko, T. Ahiko); National Institute of Infectious Diseases, Tokyo, Japan (M. Kuroda, T. Sekizuka, M. Noda, H. Kimura, T. Mizutani); Yonezawa City Hospital, Yamagata (M. Kurimura, Y. Yahata); and Yamagata University Faculty of Medicine, Yamagata (T. Kato, T. Kawanami)

Main Article

Table 2

Primers used to detect and sequence analysis for human parechovirus 3 among patients with epidemic myalgia, Yonezawa, Yamagata, Japan, June–August 2008

Primer Nucleotide sequence, 5′ → 3′ Nucleotide position*
Parecho3-F2K AACAAGTGACACTATGGATCTGATC 576–601
Parecho3-F3K CAAAGTAGCAGATGATGCTTCCAA 824–849
Parecho3-F4K CAAGCCAAATATTTTGCTGCAGTAA 1165–1190
Parecho3-F5K TGCATTGGTGGTTTATGAGCCTAA 1244–1268
Parecho3-F21K TCAGACAACACCACACCTTCAAG 1822–1844
Parecho3-VP1F1Y GGGCCTTTGGGTAATGAGAAA 2452–2472
Parecho3-VP1F2Y TGACAACATATTTGGTAGAGCTTGGT 2538–2563
Parecho3-F6K AGGAGATAATGTATATCAATTGGAT 3095–3120
Parecho3-F7K TGACGGCTGGTTTAATGTCAACTAT 3368–3392
Parecho3-F8K CTGAATCAATGTCCAACACAGACGA 3737–3761
Parecho3-F9K TGGACTATGCCTCTGATATTATTGT 3994–4019
Parecho3-F10K AATAATGGCCATTTGCTTTAGGAGT 4098–4122
Parecho3-F11K CTTGTAAATTAAATGGTGTGTACAC 4304–4328
Parecho3-F12K ACTAGGAAGGAGAAAGATATTGAAA 4402–4426
Parecho3-F13K CAGCCAAAGCATATAGTAGGGCTG 4609–4633
Parecho3-F14K TTGAACAAATGGAAGCCTTCATTGA 4916–4940
Parecho3-F15K GTTGTAGACTGGTTCAGTAGTAAG 5011–5034
Parecho3-F16K AAAGGAACTTTCCCAGTCACGCAGA 5201–5225
Parecho3-F17K CAGAGAGTATGTTGATTTGGATGAC 5553–5576
Parecho3-F18K GTGGCTATTCCTTTCAATTTTCTT 5778–5802
Parecho3-F19K GGCCCAGCAGTTTTAAGCAAATCAG 5863–5947
Parecho3-F20K TTGTCATGATTCACCTGATCTTGTC 6608–6633
Parecho3-R13K AGTTTGTGGTATTTACAGTGGTTGT 912–938
Parecho3-R11K TTTTAACGTAGTTTGTGTCTGCA 1380–1402
Parecho3-R15 CATGTATAGAATATGAATGTTTATT 2673–2697
Parecho3-VP1R2Y ACCCCTGCTCTGCCATGTATA 2693–2710
Parecho3-VP1R1Y TCCCGTGCATCATTGGTCTA 2883–2902
Parecho3-R10K TGACAGATGATTCAAGATACTTCAC 3238–3253
Parecho3-R9K AGTGGTACACTTCTGCACAAGTAAG 3468–3492
Parecho3-R8K ATCCACCAATCAATATGTCTGAATG 3859–3884
Parecho3-R7K TGGATAGTGTGTGTGTTAGGAAAGA 4264–4288
Parecho3-R5K CCACTTTAGAAATAAGCAGACCACC 5701–5725
Parecho3-R4K CCATTTTGACTTCCACTGCTCCA 5901–5923
Parecho3-R3K CCTAAATTTGGACTTGACACAGG 5993–6015
HPeV3whole-RT-RK TTTTGGTATGTCCAATATTCCAAATTAGTG 7296–7321

*Relative to human parechovirus 3 strain A308/99 (GenBank accession no. AB084913).

Main Article

1Current affiliation: Tokyo University of Agriculture and Technology Research and Education Center for Prevention of Global Infectious Diseases of Animals, Tokyo, Japan.

Top of Page

USA.gov: The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO