Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 18, Number 12—December 2012

CME ACTIVITY

Enterovirus 71–associated Hand, Foot, and Mouth Disease, Southern Vietnam, 2011

Truong Huu Khanh, Saraswathy Sabanathan, Tran Tan Thanh, Le Phan Kim Thoa, Tang Chi Thuong, Vu thi Ty Hang, Jeremy Farrar, Tran Tinh Hien, Nguyen van Vinh Chau, and H. Rogier van DoornComments to Author 
Author affiliations: Author affiliations: Children’s Hospital 1, Ho Chi Minh City, Vietnam (T.H. Khanh, L.P.K. Thoa, T.C. Thuong); Oxford University Clinical Research Unit, Oxford, UK (S. Sabanathan, T.T. Thanh, V.t.T. Hang, J. Farrar, T.T. Hien, H.R. van Doorn); Oxford University (S. Sabanathan, J. Farrar, T.T. Hien, H.R. van Doorn); Hospital for Tropical Diseases, Ho Chi Minh City (N.v.V. Chau)

Main Article

Table 2

Primers and probes used in study of EV71-associated hand, foot, and mouth disease, Children’s Hospital 1, Ho Chi Minh City, Vietnam, September 18–November 30, 2011*

Assay Primer and probe Sequence, 5′ → 3′ GenBank accession no. PCR product size, bp
EV71 real-time RT-PCR
EV71-VP1-634F GGAGAACACAARCARGAGAAAGA AM490160.1
Real-time analysis
EV71-VP1-743R ACTAAAGGGTACTTGGACTTVGA
EV71-VP1-TaqMan
FAM-TGATGGGCACGTTCTCAGTGCG-BHQ1
CVA16 RT-PCR
CoxA-VP1-526F AACCCATCTGTGTTTGTGAAAA JF317969.1
110
CoxA-VP1-635R
CCGAAGGTGGGATAACCAT
EV71 VP1 sequencing EV71-VP1-3F AGAYAGGGTGGCRGATGT AM490160.1 701
EV71-VP1-703R CTGAGAACGTGCCCATCA

*EV71, enterovirus 71; RT-PCR, reverse transcription PCR; VP, viral protein; FAM,  carboxyfluorescein; BHQ1, black hole quencher 1; CVA16, coxsackievirus A16; CoxA, coxsackievirus.

Main Article

TOP