Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 18, Number 2—February 2012

Dispatch

Phylogeography of Francisella tularensis subsp. holarctica, Europe

Miklós Gyuranecz1, Dawn N. Birdsell1, Wolf Splettstoesser, Erik Seibold, Stephen M. Beckstrom-Sternberg, László Makrai, László Fodor, Massimo Fabbi, Nadia Vicari, Anders Johansson, Joseph D. Busch, Amy J. Vogler, Paul Keim, and David M. WagnerComments to Author 
Author affiliations: Hungarian Academy of Sciences, Budapest, Hungary (M. Gyuranecz); Northern Arizona University, Flagstaff, Arizona, USA (D.N. Birdsell, J.D. Busch, A.J. Vogler, P. Keim, D.M. Wagner); Bundeswehr Institute of Microbiology, Munich, Germany (W. Splettstoesser, E. Seibold); Translational Genomics Research Institute, Phoenix, Arizona, USA (S.M. Beckstrom-Sternberg, P. Keim); Szent István University, Budapest (L. Makrai, L. Fodor); Istituto Zooprofilattico Sperimentale della Lombradia e dell’Emilia Romagna, Pavia, Italy (M. Fabbi, N. Vicari); Umeå University, Umeå, Sweden (A. Johansson)

Main Article

Table

Melt-MAMA primers targeting canonical SNPs for 6 new phylogenetic branches in a study of Francisella tularensis subsp. holarctica, Europe*

SNP SCHU† S4 position SNP state, D/A‡ Primers, 5′ → 3′§ Con, µM¶ Tm, °C
B.33 78,382 T/C A: ATTGCTACTTCTATTTACGCCAACAG 0.20 74.3
D: GGGGCGGGGCGGGGCATTGCTACTTCTATTTACGCCAAGAA 0.20 79.0
C: TGTGAACAACCAAGTTGGCTT 0.20
B.34 766,614 A/G A: GTAGCGAGCATTATTTGCTGGTTC 0.40 69.2
D: GGGGCGGGGCGGGGCTAGCGAGCATTATTTGCTGGGTT 0.20 78.6
C: ATAAAACTATAAATTTACATAAAATGAAAACTTCTC 0.20
B.35 239,479 A/C A: GCCTTAATCTAGTATTTTCGCTTATCTCC 0.40 70.3
D: GGGGCGGGGCGGGGCGCCTTAATCTAGTATTTTCGCTTATCACA 0.20 75.5
C: CGGGCTCTAAAATAAGATTTAAGTTAGTAAGT 0.20
B.36 1,599,292 A/C A: TATTATAGTTTCTAAAAACAGTCTAATTAATTTTG 0.60 69.0
D: GGGGCGGGGCGGGGCTATTATAGTTTCTAAAAACAGTCTAATTAATTGTT 0.20 73.9
C: GTTCGACCATGACTACAGTGTTG 0.20
B.37 318,602 T/C A: AACATTTTAGGAACTCTACGATGATAAACTTAAC 0.20 69.7
D: GGGGCGGGGCGGGGCCATTTTAGGAACTCTACGATGATAAACTTGAT 0.20 75.9
C: GAAATATCTCAATGAAATCTAATTTAACTAAAATCAC 0.20
B.38 166,885 C/T A: ATGCCATCAGCCATTTACTACTCACA 0.20 73.7
D: GGGGCGGGGCGGGGCCCATCAGCCATTTACTACTCCCG 0.20 80.1
C: CTTCCCTGATTTTCTAAGTTCTGCTTG 0.20

*Melt-MAMA, melt-mismatch amplification mutation assay; SNP, single nucleotide polymorphism; con, concentration; Tm, melting temperature for ancestral and derived Melt-MAMA amplification products.
†SCHU strain GenBank accession no. NC_006570.
‡SNP states are presented according to their orientation in the SCHU S4 reference genome (AJ749949.2): D, derived SNP state; A, ancestral SNP state.
§D, derived allele primer; A, ancestral allele primer; C, common primer; primer tails and antepenultimate mismatch bases are in lower case.
¶Final concentration of each primer in Melt-MAMA genotyping assays.

Main Article

1These authors contributed equally to this article.

TOP