Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 18, Number 3—March 2012

Research

Pathogenic Potential to Humans of Bovine Escherichia coli O26, Scotland

Margo E. Chase-ToppingComments to Author , Tracy Rosser, Lesley J. Allison, Emily Courcier, Judith Evans, Iain J. McKendrick, Michael C. Pearce, Ian Handel, Alfredo Caprioli, Helge Karch, Mary F. Hanson, Kevin G.J. Pollock, Mary E. Locking, Mark E.J. Woolhouse, Louise Matthews, J. Chris Low, and David L. Gally
Author affiliations: University of Edinburgh, Edinburgh, UK (M.E. Chase-Topping, E. Courcier, M.C. Pearce, M.E.J. Woolhouse); The Roslin Institute and Royal (Dick) School of Veterinary Studies, Edinburgh (T. Rosser, I. Handel, D.L. Gally); Scottish E. coli O157/VTEC Reference Laboratory, Edinburgh (L.J. Allison, M.F. Hanson); Scottish Agricultural College, Edinburgh (J. Evans, M.C. Pearce, J.C. Low); Biomathematics and Statistics Scotland, Edinburgh (I.J. McKendrick); Istituto Superiore di Sanità, Rome, Italy (A. Caprioli); University of Münster, Münster, Germany (H. Karch); Health Protection Scotland, Glasgow, UK (K.G.J. Pollock, M.E. Locking); University of Glasgow Veterinary School, Glasgow (L. Matthews)

Main Article

Table 2

Primers and PCR conditions for Escherichia coli O26, Scotland

Primer name Primer sequence, 5′ → 3′ Target gene Annealing Amplicon size, bp Reference
stx1F
stx1R ATAAATCGCCATTCGTTGACTAC
AGAACGCCCACTGAGATCATC stx1 60°C,45 s 180 (24)
stx2F
stx2R GGCACTGTCTGAAACTGCTCC
TCGCCAGTTATCTGACATTCTG stx2 60°C,45 s 255 (24)
eaeAF
eaeAR GACCCGGCACAAGCATAAGC
CCACCTGCAGCAACAAGAGG eae 60°C,45 s 384 (24)
hlyAF
hlyAR GCATCATCAAGCGTACGTTCC
AATGAGCCAAGCTGGTTAAGCT hlyA 60°C,45 s 534 (24)
sepLF
sepLR GCTAAGCCTGGGATATCGC
ACAATCGATACCCGAGAAGG sepL 60°C,45 s 725 This study
univ tccP/tccp2-F
tccP-R GTAAAAACCAGCTCACCTTTTTC
TCACGAGCGCTTAGATGTATTAAT tccptccP2 64°C,60 s Variable (25)
espAF
espAR CCTTCTCGGGTATCGATTGTCG
CAGAGGGCGTCACTAATGAGTG espA 58°C,60 s 1012 This study
LEE1promF
LEE1promR CGAATGGTACGGTTATGCGGG
GCTCTCGCAGTCGCTTTGCTTCC LEE1 58°C,60 s 645 This study

Main Article

TOP