Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 18, Number 3—March 2012


Causes of Pneumonia Epizootics among Bighorn Sheep, Western United States, 2008–2010

Thomas E. BesserComments to Author , Margaret A. Highland, Katherine Baker, E. Frances Cassirer, Neil J. Anderson, Jennifer M. Ramsey, Kristin Mansfield, Darren L. Bruning, Peregrine Wolff, Joshua B. Smith, and Jonathan A. Jenks
Author affiliations: Washington State University, Pullman, Washington, USA (T.E. Besser, M.A. Highland, K. Baker); Washington Animal Disease Diagnostic Laboratory, Pullman (T.E. Besser); US Department of Agriculture Agricultural Research Service, Pullman (M.A. Highland); Idaho Department of Fish and Game, Lewiston, Idaho, USA (E.F. Cassirer); Montana Fish, Wildlife and Parks, Bozeman, Montana, USA (N.J. Anderson, J.M. Ramsey); Washington Department of Fish and Wildlife, Spokane Valley, Washington, USA (K. Mansfield); US Department of Agriculture Animal and Plant Health Inspection Service, Olympia, Washington, USA (D.L. Bruning); Nevada Department of Wildlife, Reno, Nevada, USA (P. Wolff); South Dakota State University, Brookings, South Dakota, USA (J.B. Smith, J.A. Jenks)

Main Article

Table 2

PCR primers used to detect etiologic agents of pneumonia in bighorn sheep, western United States, 2008–2010

Species (gene target) Primer Primer sequence, 5′ → 3′ Reference
Mannheimia haemolytica, Bibersteiniatrehalosi, M. haemolytica (gcp) Mhgcp AGAGGCCAATCTGCAAACCTCG (21)
Bibersteinia trehalosi (sodA) BtsodAF GCCTGCGGACAAACGTGTTG (21)
Pasteurella multocida (kmt1) KMT1T7 ATCCGCTATTTACCCAGTGG (27)
Mycoplasma ovipneumoniae (16S) LMF TGAACGGAATATGTTAGCTT (28)
M. ovipneumoniae (16S–23S intergenic spacer) MoIGSF GGAACACCTCCTTTCTACGG This study

Main Article