Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 18, Number 4—April 2012

Letter

Rickettsia monacensis as Cause of Mediterranean Spotted Fever–like Illness, Italy

Giordano MadedduComments to Author , Fabiola Mancini, Antonello Caddeo, Alessandra Ciervo, Sergio Babudieri, Ivana Maida, Maria Laura Fiori, Giovanni Rezza, and Maria Stella Mura
Author affiliations: University of Sassari, Sassari, Italy (G. Madeddu, A. Caddeo, S. Babudieri, I. Maida, M.L. Fiori, M.S. Mura); Istituto Superiore di Sanità, Rome, Italy (F. Mancini, A. Ciervo, G. Rezza)

Main Article

Table

Selected inner primers used to amplify rickettsial gltA and ompA genes*

Rickettsial groups Gene Primer Nucleotide sequence, 5′ → 3′ Product size, bp Reference
Rickettsiae spotted fever group plus typhus group gtlA gltA–F TCGCAAATGTTCACGGTACTTT 74 (8)
gltA–R TCGTGCATTTCTTTCCATTGTG
Rickettsiae ompA ompA ompA–F ATGGCGAATATTTCTCCAAAA 632 (9)
ompA–R GTTCCGTTAATGGCAGCATCT

*gltA, citrate synthase; ompA, outer membrane protein A.

Main Article

TOP