Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 18, Number 5—May 2012

Research

Temporal Trends in Bordetella pertussis Populations, Denmark, 1949–2010

Randi Føns PetersenComments to Author , Tine Dalby, Ditte Marie Dragsted, Frits Mooi, and Lotte Lambertsen
Author affiliations: Statens Serum Institut, Copenhagen, Denmark (R.F. Petersen, T. Dalby, L. Lambertsen); private practitioner, Frederiksberg, Denmark (D.M. Dragsted); National Institute for Public Health and the Environment (RIVM), Bilthoven, the Netherlands (F. Mooi)

Main Article

Table 1

Primers used for MLVA and MASTdk typing in a study of temporal trends in Bordetella pertussis populations, Denmark, 1949–2009*

Primer name Target Sequence, 5′ → 3′ Reference
BP-VNTR1-DF VNTR1 FAM-CCTGGCGGCGGGAGACGTGGTGGTG (9)
BP-VNTR1-DR VNTR1 AAAATTGCGGCATGTGGGCTGACTCTGA (9)
BP-VNTR3-BF VNTR3 FAM -GCCTCGGCGAAATTGCTGAAC (9)
BP-VNTR3-BR VNTR3 GCGGGCGAGGAAACGCCCGAGACC (9)
BP-VNTR4-CF VNTR4 FAM-CGTGCCCTGCGCCTGGACCTG (9)
BP-VNTR4-BR VNTR4 GCCGCTGCTCGACGCCAGGGACAA (9)
BP-VNTR5-BF VNTR5 FAM-GAAGCCGGCCCACCCGAGCTCCAGGCTCTT (9)
BP-VNTR5-BR VNTR5 TGCCGGGTTTCGGCATCTCGATGGGATACG (9)
BP-VNTR6-EF VNTR6 FAM-CCAACGGCGGTCTGCTGGGTGGTC (9)
BP-VNTR6-FR VNTR6 AGGGCGCTGGTCACGCCACCGAGGAT (9)
BP-PtxP-F Pertussis toxin promoter AATCGTCCTGCTCAACCGCC (10)
BP-PtxP-R Pertussis toxin promoter GGTATACGGTGGCGGGAGGA (10)
BP-Ptx S1-F2 Pertussis toxin Subunit 1 CCCCCTGCCATGGTGTGATC (11,12)
BP-Ptx S1-R2 Pertussis toxin Subunit 1 AGAGCGTCTTGCGGTCGATC (11,12)
BP-prn-AF Pertactin region 1 GCCAATGTCACGGTCCAA (1113)
BP-Prn-AR Pertactin region 1 GCAAGGTGATCGACAGGG (1113)
BP-Prn-BF Pertactin region 2† AGCTGGGCGGTTCAAGGT (1113)
BP-Prn-BR/ Pertactin region 2† CCGGATTCAGGCGCAACTC (1113)
BP-tcfAF Tracheal colonization factor TTCTTGCGCGTCGTGTCTTC (9)
BP-tcfAR3 Tracheal colonization factor GCGGTTGCGGACCTTCAT (9)

*MLVA, multilocus variable-number tandem repeat analysis; MASTdk, multiple antigen sequence typing results obtained in Denmark; VNTR, variable-number tandem repeat.
†Pertactin region 2 was sequenced to confirm prn allele type (1 or 7).

Main Article

TOP