Skip directly to search Skip directly to A to Z list Skip directly to site content
CDC Home

Volume 18, Number 5—May 2012


Temporal Trends in Bordetella pertussis Populations, Denmark, 1949–2010

Randi Føns PetersenComments to Author , Tine Dalby, Ditte Marie Dragsted, Frits Mooi, and Lotte Lambertsen
Author affiliations: Statens Serum Institut, Copenhagen, Denmark (R.F. Petersen, T. Dalby, L. Lambertsen); private practitioner, Frederiksberg, Denmark (D.M. Dragsted); National Institute for Public Health and the Environment (RIVM), Bilthoven, the Netherlands (F. Mooi)

Main Article

Table 1

Primers used for MLVA and MASTdk typing in a study of temporal trends in Bordetella pertussis populations, Denmark, 1949–2009*

Primer name Target Sequence, 5′ → 3′ Reference
BP-PtxP-F Pertussis toxin promoter AATCGTCCTGCTCAACCGCC (10)
BP-PtxP-R Pertussis toxin promoter GGTATACGGTGGCGGGAGGA (10)
BP-Ptx S1-F2 Pertussis toxin Subunit 1 CCCCCTGCCATGGTGTGATC (11,12)
BP-Ptx S1-R2 Pertussis toxin Subunit 1 AGAGCGTCTTGCGGTCGATC (11,12)
BP-prn-AF Pertactin region 1 GCCAATGTCACGGTCCAA (1113)
BP-Prn-AR Pertactin region 1 GCAAGGTGATCGACAGGG (1113)
BP-Prn-BF Pertactin region 2† AGCTGGGCGGTTCAAGGT (1113)
BP-Prn-BR/ Pertactin region 2† CCGGATTCAGGCGCAACTC (1113)
BP-tcfAF Tracheal colonization factor TTCTTGCGCGTCGTGTCTTC (9)
BP-tcfAR3 Tracheal colonization factor GCGGTTGCGGACCTTCAT (9)

*MLVA, multilocus variable-number tandem repeat analysis; MASTdk, multiple antigen sequence typing results obtained in Denmark; VNTR, variable-number tandem repeat.
†Pertactin region 2 was sequenced to confirm prn allele type (1 or 7).

Main Article

Top of Page The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO