Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 18, Number 6—June 2012

Research

Virulence Potential of Fusogenic Orthoreoviruses

Ann H. WongComments to Author , Peter K.C. Cheng, Mary Y.Y. Lai, Peter C.K. Leung, Kitty K.Y. Wong, W.Y. Lee, and Wilina W.L. Lim
Author affiliations: Centre for Health Protection, Hong Kong Special Administrative Region, People’s Republic of China

Main Article

Table

Primers used to amplify the 4 small gene segments of fusogenic orthoreovirus from 3 travelers who had returned from Indonesia to Hong Kong during 2007–2010

Sequence, 5′ → 3′ Polarity
Segment 1
ATGAGTGGTGATTGTGC Forward
GATCTGATCGCGAAGCG Reverse
GCTTTGATCATGACGATG Forward
GTGTCGATTGAGAAAGTGA Reverse
Segment 2
CCCACGGACCAACGACAAC Forward
AAAGCGCTTAGCTGAGAAGCG Reverse
GAGACGTGGCCTAATATGTTG Forward
GATGATTAGACCACGGCTGAG Reverse
Segment 3
GCGGGTACTGGGTCTCAGA Forward
GCTTAGCACCAAAGGAAGTTACG Reverse
GTCATCGCGAAGTTTTCAGAAC Forward
CTCCTGTCGATGCTCACCA Reverse
Segment 4
CGCAAGCCCAGATGGAGGT Forward
CGGAGTGACAATGACATGTTCAG Reverse
CGTTTCCACATCATCGCTGTC Forward
AGAGCATAGTGCGATGGTGTC Reverse

Main Article

TOP