Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 18, Number 7—July 2012

Dispatch

Role of Birds in Dispersal of Etiologic Agents of Tick-borne Zoonoses, Spain, 2009

Ana M. Palomar, Paula Santibáñez, David Mazuelas, Lidia Roncero, Sonia Santibáñez, Aránzazu Portillo, and José A. OteoComments to Author 
Author affiliations: Hospital San Pedro–Centro de Investigación Biomédica de La Rioja, Logroño, Spain (A.M. Palomar, P. Santibáñez, S. Santibáñez, A. Portillo, J.A. Oteo); and Environment Resources Inc., Logroño (D. Mazuelas, L. Roncero)

Main Article

Table 1

PCR primer pairs used in study of the role of birds in dispersal of etiologic agents of tick-borne zoonoses, Spain, 2009*

Bacteria Gene target Primer name Primer sequence, 5′ → 3′ Amplified
fragment, bp Annealing temp., °C Ref.
Anaplasma spp. 16S rRNA,
nested ge3a CACATGCAAGTCGAACGGATTATTC 932 55 (9)
ge10r TTCCGTTAAGAAGGAT CTAATCTCC
ge9f AACGGATTATTCTTTATAGCTTGCT 546 55 (9)
ge2 GGCAGTATTAAAAGCAGCTCCAGG
msp msp3F CCAGCGTTTAGCAAGATAAGAG 334 56 (10)
msp3R GCCCAGTAACAACATCATAAGC
Borrelia spp. flaB,
nested† Outer 1 AARGAATTGGCAGTTCAATC 497 52 (11)
Outer 2 GCATTTTCWATTTTAGCAAGTGATG
Inner 1 ACATATTCAGATGCAGACAGAGGTTCTA 389 55 (11)
Inner 2 GAAGGTGCTGTAGCAGGTGCTGGCTGT
5S-23S intergenic spacer, nested 23SC1 TAAGCTGACTAATACTAATTACCC 380 52 (12)
23SN1 ACCATAGACTCTTATTACTTTGAC
5SCB GAGAGTAGGTTATTGCCAGGG 226 55 (12)
23SN2 ACCATAGACTCTTATTACTTTGACCA
Rickettsia spp. ompA,
seminested Rr190.70p ATGGCGAATATTTCTCCAAAA 631 46 (13,14)
Rr190.701n GTTCCGTTAATGGCAGCATCT
Rr190.70p ATGGCGAATATTTCTCCAAAA 532 48 (14)
Rr190.602n AGTGCAGCATTCGCTCCCCCT
ompB, nested rompB OF GTAACCGGAAGTAATCGTTTCGTAA 511 54 (15)
rompB OR GCTTTATAACCAGCTAAACCACC
rompB SFG IF GTTTAATACGTGCTGCTAACCAA 420 56 (15)
rompB SFG/TG IR GGTTTGGCCCATATACCATAAG
gltA central region,
nested RpCS.877p GGGGGCCTGCTCACGGCGG 381 48 (14)
RpCS1258n ATTGCAAAAAGTACAGTGAACA
RpCS.896p GGCTAATGAAGCAGTGATAA 337 54 (15)
RpCS.1233n GCGACGGTATACCCATAGC

*Temp., temperature; ref., reference; msp, p44 major surface protein gene; flaB, flagellin gene; ompB, 120-kDa genus common antigen gene; ompA, 190-kDa protein antigen gene; gltA, citrate synthase gene.
†R = A/G; W = A/T.

Main Article

TOP