Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 18, Number 8—August 2012

Letter

Rickettsia felis in Fleas, Southern Ethiopia, 2010

Oleg Mediannikov, Alemseged Abdissa, Georges Diatta, Jean-François Trape, and Didier RaoultComments to Author 
Author affiliations: Institut de Recherche pour le Développement, Dakar, Senegal (O. Mediannikov, G. Diatta, J.-F. Trape); Jimma University, Jimma, Ethiopia (A. Abdissa); and Aix Marseille University, Faculté de Médecine, Marseille, France (D. Raoult)

Main Article

Table

Sequences of primers and probes used to identify fleas by quantitative real-time PCR, southern Ethiopia, 2010

Species Forward primer, 3′→5′ Reverse primer, 3′→5′ Fluorescent probe
P. irritans CGAATACTTTTAGAAAGCCAAAACA CATTGATGACCAATAGATTTTAGAGTG TTGCTTTACCGTCTTTACGTTT
C. felis TCGTTATTTACTTGAAAGACAAAATG TCATTGATGACCAATTGCTTT TGCTTTACCTTCTCTTCGACTTTT

*P., Pulex; C., Ctenocephalides.

Main Article

TOP