Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 18, Number 8—August 2012

Dispatch

Escherichia coli O104 Associated with Human Diarrhea, South Africa, 2004–2011

Nomsa P. TauComments to Author , Parastu Meidany, Anthony M. Smith, Arvinda Sooka, Karen H. Keddy, and for the Group for Enteric, Respiratory, and Meningeal Disease Surveillance in South Africa
Author affiliations: National Health Laboratory Services, Johannesburg, South Africa (N.P. Tau, A.M. Smith, A. Sooka, K.H. Keddy); University of the Witwatersrand, Johannesburg (P. Meidany, A.M. Smith, K.H. Keddy)

Main Article

Table 1

PCR primers used for amplification of Escherichia coli genes, South Africa

Gene target* Primer sequence, 5′ → 3′ Size of amplification product, bp Multiplex PCR in which primers are included Reference
stx1 CAGTTAATGTGGTGGCGAAGG 348 A (10)
CACCAGACAATGTAACCGCTG A (10)
stx2 ATCCTATTCCCGGGAGTTTACG 584 A (10)
GCGTCATCGTATACACAGGAGC A (10)
eae TCAATGCAGTTCCGTTATCAGTT 482 A (11)
GTAAAGTCCGTTACCCCAACCTG A (11)
est ATTTTTCTTTCTGTATTGTCTT 190 B (12)
CACCCGGTACAAGCAGGATT B (12)
elt GGCGACAGATTATACCGTGC 440 B (12)
CGGTCTCTATATTCCCTGTT B (12)
ipaH CTCGGCACGTTTTAATAGTCTGG 933 C (11)
GTGGAGAGCTGAAGTTTCTCTGC C (11)
aat CTGGCGAAAGACTGTATCAT 630 C (13)
CAATGTATAGAAATCCGCTGTT C (13)
daaC CAGGTCATCCGGTCAGTCGG 212 C This study
CAATGCCACGTACAACCGGC C This study

*stx, Shiga toxin; eae, intimin outer membrane protein; est, heat-stable enterotoxin; elt, heat-labile enterotoxin; ipaH, invasion protein; aat, transporter protein; daaC, accessory protein with a function in F1845 fimbriae production.

Main Article

TOP