Skip directly to search Skip directly to A to Z list Skip directly to site content
CDC Home

Volume 18, Number 8—August 2012

Dispatch

Escherichia coli O104 Associated with Human Diarrhea, South Africa, 2004–2011

Nomsa P. TauComments to Author , Parastu Meidany, Anthony M. Smith, Arvinda Sooka, Karen H. Keddy, and for the Group for Enteric, Respiratory, and Meningeal Disease Surveillance in South Africa
Author affiliations: National Health Laboratory Services, Johannesburg, South Africa (N.P. Tau, A.M. Smith, A. Sooka, K.H. Keddy); University of the Witwatersrand, Johannesburg (P. Meidany, A.M. Smith, K.H. Keddy)

Main Article

Table 1

PCR primers used for amplification of Escherichia coli genes, South Africa

Gene target* Primer sequence, 5′ → 3′ Size of amplification product, bp Multiplex PCR in which primers are included Reference
stx1 CAGTTAATGTGGTGGCGAAGG 348 A (10)
CACCAGACAATGTAACCGCTG A (10)
stx2 ATCCTATTCCCGGGAGTTTACG 584 A (10)
GCGTCATCGTATACACAGGAGC A (10)
eae TCAATGCAGTTCCGTTATCAGTT 482 A (11)
GTAAAGTCCGTTACCCCAACCTG A (11)
est ATTTTTCTTTCTGTATTGTCTT 190 B (12)
CACCCGGTACAAGCAGGATT B (12)
elt GGCGACAGATTATACCGTGC 440 B (12)
CGGTCTCTATATTCCCTGTT B (12)
ipaH CTCGGCACGTTTTAATAGTCTGG 933 C (11)
GTGGAGAGCTGAAGTTTCTCTGC C (11)
aat CTGGCGAAAGACTGTATCAT 630 C (13)
CAATGTATAGAAATCCGCTGTT C (13)
daaC CAGGTCATCCGGTCAGTCGG 212 C This study
CAATGCCACGTACAACCGGC C This study

*stx, Shiga toxin; eae, intimin outer membrane protein; est, heat-stable enterotoxin; elt, heat-labile enterotoxin; ipaH, invasion protein; aat, transporter protein; daaC, accessory protein with a function in F1845 fimbriae production.

Main Article

Top of Page

USA.gov: The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO