Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 18, Number 8—August 2012

Research

Hepatitis E Virus Strains in Rabbits and Evidence of a Closely Related Strain in Humans, France

Jacques IzopetComments to Author , Martine Dubois, Stéphane Bertagnoli, Sébastien Lhomme, Stéphane Marchandeau, Samuel Boucher, Nassim Kamar, Florence Abravanel, and Jean-Luc Guérin
Author affiliations: Institut National de la Santé et de la Recherche Médicale, Toulouse, France (J. Izopet, M. Dubois, S. Lhomme, N. Kamar, F. Abravanel); Faculté de Médecine Toulouse-Purpan, Université Toulouse III Paul-Sabatier, Toulouse (J. Izopet, S. Lhomme, N. Kamar, F. Abravanel); Le Centre Hospitalier Universitaire de Toulouse, Toulouse (J. Izopet, M. Dubois, S. Lhomme, N. Kamar, F. Abravanel); École Nationale Vétérinaire de Toulouse, Toulouse (S. Bertagnoli, J.-L. Guérin); Office National de la Chasse et de la Faune Sauvage, Nantes, France (S. Marchandeau); and Labovet, Les Herbiers, France (S. Boucher )

Main Article

Table 2

Primers used to amplify and sequence the whole genome of HEV strains, France*

Fragment size, bp Nucleotide position† Primer Sequence, 5′ → 3′
225 15–238 Sense ATGTGGTCGATGCCATGGAGGCCCA
Antisense CTCATTATGTATAACACGTTGAATAG
2,900 152–3937 Sense AGACAGATATTCTTATCAATTTAATGCAACCCCGC
Antisense GCCGCAAGTAACACGGGCGGCCGTGTGAGGTGTGAA
2,000 3207–5212 Sense AAGTCTAGGTCTATACAGCAGGG
Antisense GCCGGTGGCGCGGGCAGCATAGGCA
2,160 5060–7208 Sense AATGTYGCYCAGGTYTGTG
Antisense TTTTTTTTTTTTCCYGGGRGCGC

*HEV, hepatitis E virus.
†Nucleotide position refers to Burma strain, M73218.

Main Article

TOP