Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 18, Number 8—August 2012

Letter

Identification of Cause of Posttransplant Cachexia by PCR

Joelle GuitardComments to Author , Sophie Edouard, Hubert Lepidi, Christine Segonds, Marion Grare, Marie-Laure Ranty-Quintyn, Isabelle Rouquette, Olivier Cointault, Lionel Rostaing, Nassim Kamar, and Florence Fenollar
Author affiliations: Centre Hospitalier Universitaire Rangueil, Toulouse, France (J. Guitard, C. Segonds, M. Grare, M.-L. Ranty-Quintyn, I. Rouquette, O. Cointault, L. Rostaing, N. Kamar); Université Aix-Marseille, Marseille, France (S. Edouard, H. Lepidi, F. Fenollar); Pôle de Maladies Infectieuses, Marseille (S. Edouard, F. Fenollar); and Université Paul Sabatier, Toulouse (L. Rostaing, N. Kamar)

Main Article

Table A1

Approach used to determine the cause of posttransplant cachexia in a patient*

Pathogen Sequence target Primers, 5′ → 3′ Probes/identification
Molecular tool to detect and identify Tropheryma whipplei
Real-time PCR
T. whipplei Repeated sequence Twhi2F: TGAGGATGTATCTGTGTATGGGACA 6-FAM-GAGAGATGGGGTGCAGGACAGGG-TAMRA
Twhi2R: TCCTGTTACAAGCAGTACAAAACAAA
T. whipplei Repeated sequence Twhi3F: TTGTGTATTTGGTATTAGATGAAACAG 6-FAM-GGGATAGAGCAGGAGGTGTCTGTCTGG-TAMRA
Twhi3R:
CCCTACAATATGAAACAGCCTTTG
Molecular tools to detect and identify Mycobacterium spp.
Step 1: Real-time PCR
Mycobacterium spp. ITS ITSd: GGGTGGGGTGTGGTGTTTGA
ITSr: CAAGGCATCCACCATGCGC 6-FAM-TGGATAGTGGTTGCGAGCATC-TAMRA
M. tuberculosis ITS ITSd: GGGTGGGGTGTGGTGTTTGA
ITSr: CAAGGCATCCACCATGCGC 6-FAM-GCTAGCCGGCAGCGTATCCAT-TAMRA
M. avium ITS ITSd: GGGTGGGGTGTGGTGTTTGA
ITSr: CAAGGCATCCACCATGCGC 6-FAM-GGCCGGCGTTCATCGAAAT-Mgb
Step 2: Classical PCR
Mycobacterium spp. rpoB MycoF: GGCAAGGTCACCCCGAAGGG
MycoR: AGCGGCTGCTGGGTGATCATC Sequencing
Housekeeping gene β-actin ActinF: CATGCCATCCTGCATCTGGA
ActinR: CCGTGGCCATCTCTTGCTCG 6-FAM-CGGGAAATCGTGCGTGACATTAAG-TAMRA

*ITS, internal transcribed spacer; rpoB, RNA polymerase B.

Main Article

TOP