Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 19, Number 10—October 2013

Research

Genetic Recombination and Cryptosporidium hominis Virulent Subtype IbA10G2

Na Li, Lihua Xiao, Vitaliano A. Cama, Ynes Ortega, Robert H. Gilman, Meijin Guo, and Yaoyu FengComments to Author 
Author affiliations: East China University of Science and Technology, Shanghai, China (N. Li, M. Guo, Y. Feng); Centers for Disease Control and Prevention, Atlanta, Georgia, USA (N. Li, L. Xiao, V.A. Cama); University of Georgia, Griffin, Georgia, USA (Y. Ortega); Johns Hopkins University, Baltimore, Maryland, USA (R.H. Gilman)

Main Article

Table 1

Primer sequences of 24 additional microsatellite and minisatellite loci used in the multilocus typing analysis of Cryptosporidium hominis*

No. Locus Polymorphism Primer Sequence, 5′→3′ PCR product , bp
1 C6–60 Microsatellite F1 TGGACAAGAGTGTCGCTTCTA ≈866
CAC R1 GTATTGGGTCCTTTCAGCTCA
F2 TCCAAAGTACACTGCGTAAATAT
R2 TCATGTCTCAACATGCTGAGTA
2 C6–160 Microsatellite F1 GTACTCAAGTTCCAGTTGTGGA ≈582
TA R1 CCAATACATTCAGAAGACAGTCT
F2 CATCCTCAGAAGAGTACTGTA
R2 GTGCTGAATGGCTTCCTATTA
3 C6–190 Microsatellite- F1 CTATCTCTCAAGCAATGCAAAC ≈534
AAT R1 CAAGCTCCATCAGATTATCAATA
F2 CAAGTACTGGAATAGTTACTCA
R2 CTGGCAATACGTAATGCCTTT
4 C6–230 Microsatellite F1 GGCCACTTCATGGTAATACTC ≈627
TAA R1 GTCAACGAATCATCCAGAGATT
F2 GGTACAATTGGAGGTATCAGT
R2 GAATCTCGAACCTGAAGACTT
5 C6–280 Microsatellite F1 GATTAAAATCAGGCGGGCCAA ≈764
TCA R1 GAGCAATTTCTTGAATAATATTGAG
F2 GAGGACTGTGGGGGAATATAA
R2 GACAGGAAATCCAATCAATGAATTT
6 C6–350 Microsatellite F1 GTTCTTTCAATTGTGTACCATGA ≈715
ATT R1 GCTATTGGTTCAAATAATGGTATGA
F2 GCATCGCAAATCATCATCTATTT
R2 CTACATGGGATTGTTTATATGATA
7 C6–500′ Microsatellite F1 GACAAAGAGTATTAGCATCGACA ≈484
ATA R1 CTTCATGCTCTAGTTCTTCTAAT
F2 GAGTCATATGAAACAGAATCTTT
R2 CAAATTGATCGAGATTTGTTGAA
8 C6–580 Microsatellite F1 CTGGATGACCAAGGTGTTAAT ≈632
TCT R1 CTGTATTGTTACTGTCAATGCTT
F2 GAGATGAATATTGAGAATGAATCCA
R2 CTCGAGATGATCGATGAATCAT
9 C6–740 Microsatellite F1 GAAACAGTTAAAGATAGCTTGGA ≈703
AT R1 GAAGATGATGGAATTCTTCTCAT
F2 GTATCTTATGTGTATTCAAGCAT
R2 CTAATTCTTTGTATGACAAGATCAT
10 C6–830′ Microsatellite F1 GAGGCCTTAAAGCTTCTTTTA ≈679
ATT R1 GCACTACAACAAGTGGTACTA
F2 GAGATTGTATTCTTCTATACCACT
R2 CAAGTTCCAATGATAGGATCAGT
11 C6–830 Microsatellite F1 GATGTATTACTACCAGAATTGAGA ≈692
TAG R1 CTACTCAATCAATGGAAGTTACT
F2 CCAACTGATGATATTCCAGTATT
R2 GGTATTATTACATCTAGTGGTGA
12 C6–870 Microsatellite F1 CAGTGACCGAATTTACTCTCT ≈801
AT R1 GTCTCTTTAGTCAAGTTTTCCT
F2 CGCTCTTCCACGTACAATTT
R2 CGAGAATAAAGCTGACATTTCTT
13 C6–1000′ Minisatellite F1 GGAGCCTAATTGTGCTCATAT ≈583
GATAAAAAG R1 GGTTATCATGCACTGACTGTA
AAGAGGGA F2 CTCAATTGCTAAAGATGCAGAT
R2 GAATCCTGTTGTTCTCCATCT
14 C6–1420 Minisatellite F1 GCATTAGAGCATCCATGGTTA ≈534
GAAAGAGA R1 CCTGTGGTCTCGATATTCATT
GCGT F2 CATCTTCAGCCGTTGATGAAA
R2 GTAAACTCCTTGGAGGTGAAT
15 C6–2600 Microsatellite F1 GAGGATGAACTTGTACTGCAAT ≈806
GCAGCT R1 CCTAGTATTGGTGGTACTTGTA
F2 GGATCGAATTCTGGGTTGAAT
R2 GTATCAACTTGCCCTGGAATA
16 C6–2970 Microsatellite F1 GACTGTATGCCTTTGTTCCTT ≈723
GA R1 GTTGAAGATACTCCTGAAGCT
F2 GAGCGTCTTGTCTACTGACTT
R2 CTGTCCTCCAGGCATTATTGA
17 C6–3110′ Minisatellite F1 GTGGATAAGAGAACCCGTCAT ≈725
TTCCTCCTA R1 CACAAATTCTGGTGGGAATAGT
F2 CCAGTGATAGTTAATCCAGCT
R2 GAGCCAGAAGTCAGTATTTCT
18 C6–3520 Microsatellite F1 GTTGGAGTATGACAATTACCTAA ≈748
TTA R1 CATCATGGAAATCTTACAGGATT
F2 GCATTGTACAACATCCATGTCT
R2 GGTGAACATTTTGGATTAGTATCT
19 C6–3520′ Microsatellite F1 CTCTGTACAGCTGGTGTAATT ≈577
TAT R1 CCTGGTGTGAATCAATGTTGT
F2 CTTCTGGAAGCTCACCAAGAA
R2 GCTCCTTATAGATTAGCTGAGT
20 C6–3690 Microsatellite F1 CTTCTGGAGATTCCATATCATTGA ≈640
TCT R1 CCTTAAGGCTGGTTGATATGATT
F2 GTGCAAGTGATATTTCCACTATCT
R2 CTGTCGAATCACTAGGCAGAA
21 C6–4110 Microsatellite F1 CGGAAGATAATGCTCAACTGT ≈709
ACA R1 CTGCCTTACTATCATTCGCAT
F2 CAAGTGGAAACATTGAGCCAA
R2 GGAACTGACTGGTTTGATGAT
22 C6–5110′ Microsatellite F1 CACTCTTAATTCCTTCATGGCT ≈533
CTC R1 GGTCAATAGGACGTATTTCTTA
F2 GCATCCTCAGCTTTAGAATTCT
R2 GGTACAGAAGATCAGCTTTCT
23 C6–5120 Microsatellite F1 GGATTGATCAGTGACAGTGAA ≈569
AT R1 CATAATTGGAGGACTATGTCAAAT
F2 GCTGTAGTTCTAAGAGTCCAT
R2 GTCTCAAATATCATTAGAACAAGGT
24 C6–5410 Microsatellite F1 GACTCAGTTCGAGAGAAGTCA ≈646
GTAGTG R1 GGTGAATCATCTTCATGCAGT
F2 CATCGAGCGTGCACTTAATCA
R2 CTCAGACTCAAGGACCTGAAT

*All annealing temperatures for primers were 55°C. F, forward; R, reverse.

Main Article

TOP