Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 19, Number 11—November 2013


Middle East Respiratory Syndrome Coronavirus in Bats, Saudi Arabia

Ziad A. Memish, Nischay Mishra, Kevin J. Olival, Shamsudeen F. Fagbo, Vishal Kapoor, Jonathan H. Epstein, Rafat AlHakeem, Abdulkareem Durosinloun, Mushabab Al Asmari, Ariful Islam, Amit Kapoor, Thomas Briese, Peter Daszak, Abdullah A. Al Rabeeah, and W. Ian LipkinComments to Author 
Author affiliations: Ministry of Health, Riyadh, Saudi Arabia (Z.A. Memish, S.F. Fagbo, R. AlHakeem, A. Durosinloun, A.A. Al Rabeeah); Columbia University, New York, New York, USA (N. Mishra, V. Kapoor, A. Kapoor, T. Briese, W.I. Lipkin); EcoHealth Alliance, New York (K.J. Olival, J.H. Epstein, P. Daszak); Ministry of Health, Bisha, Saudi Arabia (M. Al Asmari); EcoHealth Alliance, Dhaka, Bangladesh (A. Islam)

Main Article

Table 1

PCRs and primers used in CoV detection*

PCRs (reference) Primers, 5′→3′ Nested fragment size, region (primer locations on the reference) genome)† Type of CoV (no.)
Nested pan-CoV-I (6) PLQ-F1, CGTTGGIACWAAYBTVCCWYTICARBTRGG ≈400 nt, RdRp (18310–187450) α-CoV (8), β-CoV (1)
Nested pan-CoV-II (7) WT-COV-F1, GGTTGGGAYTAYCCHAARTGTGA ≈430 nt, RdRp (15260–15700) α-CoV (5), β-CoV (2)
Hemi-nested RdRp-sequence assay (9) EMC-SeqRdRP-Rev, GCATWGCNCWGTCACACTTAGG ≈230 nt, RdRp (15048–15290) α-CoV (2), β-CoV (1)
Hemi-nested N-sequence assay (9) EMC-SeqN-Fwd, CCTTCGGTACAGTGGAGCCA ≈280 nt,N seq (29,549–29,860)
Nested CII-pan-CoV-III NM-CoV-2F1, ACWGTTCARGGICCWCCIGG ≈355 nt, helicase (17,060–17,410) β-CoV (2)
NM-HCOV-F2, AGAGCTCGCACTGTTGCAGGC ≈190 nt, RdRp (15068–15249) β-CoV (1, MERS CoV)
Hemi-nested CII-MERS N sequence NM-NSeq-F-1, ACTTCCTTCGGTACAGTGGAGC ≈170 nt, N seq (29545–29713)
upE and ORF1b real-time assays (8) upE-Fwd: GCAACGCGCGATTCAGTT Upstream of E gene and ORF 1b

* CoV, coronavirus; MERS, Middle East respiratory syndrome; RdRp, RNA-dependent RNA polymerase; –, not applicable; ORF, open reading frame.
†Primer locations are based on human β-CoV 2c EMC/2012, complete genome (GenBank accession no. JX869059).

Main Article