Skip directly to search Skip directly to A to Z list Skip directly to site content
CDC Home

Volume 19, Number 12—December 2013

Dispatch

Novel Cause of Tuberculosis in Meerkats, South Africa

Sven D.C. ParsonsComments to Author , Julian A. Drewe, Nicolaas C. Gey van Pittius, Robin M. Warren, and Paul D. van Helden
Author affiliations: Stellenbosch University, Tygerberg, South Africa (S.D.C. Parsons, N.C. Gey van Pittius, R.M. Warren, P.D. van Helden); Royal Veterinary College, London, UK (J.A. Drewe); South African Medical Research Council, Cape Town, South Africa (R.M. Warren, P.D. van Helden)

Main Article

Table 1

PCR analysis of the genomic regions flanking the direct-repeat region of Mycobacterium suricattae

PCR target, bp Forward primer, 5′→3′ Reverse primer, 5′ →3′ PCR result*
10–200† TACCTACGCCACCACCTCAAG TCAGTCTGCCGTGACTTCGG
966–1,518† CCCTATGTGGATGCGTGGTTG GGGTTTCGGGTTTGGCTTTCG
2,214–2,377† GTGTCGCTGGCTGAGACC GCTCCTTTCCATTTGCTGTC
3,506–3,730† ACCGATAATCGCTTGACACC CCCTCGTTCTCTAGCAGCAG +
60–262‡ ACGTAACTGCCGCAACACCTC AATATACGACATCAGCGACAA
335–906‡ CGGCTGCGAGTGGGCATTTAG TCCCTGGCGGAGTTGAACGG
1,702–1,931‡ TATCTCCGGCTCTCTTTCCA TCTTTAAGGACACCGCGTTC +
2,603–2,763‡ GTTCCGATAGGCGAGAACAG CCAGTTCGGGAAGGTAGTCA +

*–, no product; +, successful amplification.
†Upstream of M. tuberculosis H37Rv direct-repeat region.
‡Downstream of M. tuberculosis H37Rv direct-repeat region.

Main Article

Top of Page

USA.gov: The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO