Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 19, Number 12—December 2013


Zoonotic Chlamydiaceae Species Associated with Trachoma, Nepal

Deborah DeanComments to Author , James Rothschild, Anke Ruettger, Ram Prasad Kandel, and Konrad Sachse
Author affiliations: Children's Hospital Oakland Research Institute, Oakland, California, USA (D. Dean, J. Rothschild); University of California, San Francisco, California, USA (D. Dean); University of California, Berkeley, California, USA (D. Dean); Friedrich-Loeffler-Institut, Jena, Germany (A. Ruettger, K. Sachse); Lumini Eye Hospital, Bhairahawa, Nepal (R.P. Kandel)

Main Article

Table 1

Oligonucleotide primers used for the ArrayTube, quantitative real-time –PCR, and PCR for subsequent sequencing

Primer sequence, 5′→ 3′
Base pair
Chlamydia trachomatis ompA OmpA-9 TGCCGCTTTGAGTTCTGCTT 33–52§ 75 (6)
C. pneumoniae ompA Cpn ompAF1 ATAGACCTAACCCGGCCTACAATAAG 301–330 108 (6)
C. psittaciompA CpsF GCAACTCCTACGGAGTCTTAA 260–279 93 (6)
C. pecorumompA Cp-F GTTTTCGACAGAGTCCTCAA 208–227 118 This study
C. abortusompA CpaOMP1-F GCAACTGACACTAAGTCGGCTACA 763–786 82 (15)
C. suisompA Cs-F GGAGATTATGTTTTCGATCGC 195–216 122 This study
β-actin† β-actin-3 GGTGCATCTCTGCCTTACAGATC 412–434¶ 73 (6)
C. trachomatis ompA** ompAF-1 GTGCCGCCAGAAAAAGAT −60–40§ 1542 (6)
C. pneumoniae ompA** CPF1 TTACAAGCCTTGCCTGTAGGGA 70–91‡‡ 1098 (8)
C. psittaciompA** Cps-1 GTATTAAAAGTTGATGTGAATAA 217–239§§ 1022 (8)
C. suisompA** Cs-F GGAGATTATGTTTTCGATCGC 195–216 959 This study
C. pecorumompA** Cp-F GTTTTCGACAGAGTCCTCAA 208–227 966 This study

*Primers used in ArrayTube (Alere Technologies, Jena, Germany).
†Primer pairs used for real-time PCR of ompA DNA and of cDNA from RNA for 16SrRNA for detecting Chlamydiaceae.
‡Primer location based on reference strain L2/434 16SrRNA sequence.
§Primer location based on reference strain L2/434 ompA sequence.
¶Primer location based on position within intron 3 of the human β-actin sequence.
#Primer location based on position within exon 3 of the human β-actin sequence.
**Primer pairs used for PCR.
‡‡Primer location based on intergenic region of reference strain L2/434 downstream of ompA sequence.
‡‡Primer location based on C. pneumoniae strain TW183 ompA.
§§Primer location based on C. psittaci avian type C strain ompA.

Main Article