Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 19, Number 4—April 2013

Research

Circovirus in Tissues of Dogs with Vasculitis and Hemorrhage

Linlin Li, Sabrina McGraw, Kevin Zhu, Christian M. Leutenegger, Stanley L. Marks, Steven Kubiski, Patricia Gaffney, Florante N. Dela Cruz Jr, Chunlin Wang, Eric Delwart, and Patricia A. PesaventoComments to Author 
Author affiliations: Blood Systems Research Institute, San Francisco, California, USA (L. Li, E. Delwart); University of California, San Francisco (L. Li, E. Delwart); University of California School of Veterinary Medicine, Davis, California, USA (S. McGraw, K. Zhu, S.L. Marks, S. Kubiski, P. Gaffney, F.N. Dela Cruz Jr, P.A. Pesavento); IDEXX Laboratories, West Sacramento, California, USA (C.M. Leutenegger); Stanford Genome Technology Center, Stanford, California, USA (C. Wang)

Main Article

Table

Oligonucleotide primer pairs and probe for DogCV sequences*

Region and amplicon Primers Sequences, 5�?��+'3�?�
Replicate gene, 66 bases DogCV-forward CTTGCGAGAGCTGCTCCTTATAT
DogCV-reverse CTCCACTTCCGTCTTCCAGTTC

DogCV-probe
TCCGGAGATGACCACGCCCC
Capsid gene, 68 bases DogCV2-forward CTGTTGTGAAACTGAAAGAGACGAA
DogCV2-reverse TGACGTAGGTCTCCGGATACG
DogCV2 -probe AGCCTTGCCGCTGTCGCGTC

*DogCV, dog circovirus.

Main Article

TOP