Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 19, Number 7—July 2013

Dispatch

Novel Bartonella Agent as Cause of Verruga Peruana

David L. BlazesComments to Author , Kristin Mullins, Bonnie L. Smoak, Ju Jiang, Enrique Canal, Nelson Solorzano, Eric Hall, Rina Meza, Ciro Maguina, Todd Myers, Allen L. Richards, and Larry Laughlin
Author affiliations: Uniformed Services University of the Health Sciences, Bethesda, Maryland, USA (D.L. Blazes, K. Mullins, B.L. Smoak, L. Laughlin); Walter Reed Army Institute of Research, Silver Spring, Maryland, USA (B.L. Smoak); Naval Medical Research Center, Silver Spring (J. Jiang, E. Hall, T. Myers, A.L. Richards); Naval Medical Research Unit 6, Lima, Peru (E. Canal, R. Meza); Hospital San Juan de Dios, Lima (N. Solorzano); Universidad Peruana Cayetano Heredia–Tropicales, Lima (C. Maguina)

Main Article

Table

Primers used for PCR, nested PCR, and sequencing of novel Bartonella isolate from Peru, 2011–2012*

Gene Primer name Primer sequence, 5’ → 3’ Use Fragment length
rrs 16SU17F AGAGTTTGATCCTGGCTCAG PCR, nPCR, sequencing 1,424 bp
16SU1592R AGGAGGTRATCCAGCCGCA PCR, nPCR, sequencing
16SU 833R CTACCAGGGTATCTAATCCTGTT nPCR, sequencing

16S E. coli-518F
CAGCAGCCGCGGTAATAC
nPCR, sequencing

gltA BHCS 781p (F) GGGACCAGCTCATGGTGG PCR, sequencing 338 bp

BHCS 1137n (R)
AATGCAAAAAGAACAGTAAACA
PCR, sequencing

rpoB BrpoB1435F CGCATTGGTTTRCTTCGTATG PCR 589 bp
Brpo2327R GTAGACTGATTAGAACGCTG PCR, nPCR, sequencing
Brpo1696F CCTACGCATTATGGTCGTATTTG nPCR, sequencing

*nPCR, nested PCR.
gltA primers were previously described by Eremeeva et al. (4).

Main Article

TOP