Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 19, Number 9—September 2013

Research

Use of Staged Molecular Analysis to Determine Causes of Unexplained Central Nervous System Infections

Chien-Chin HsuComments to Author , Rafal Tokarz, Thomas Briese, Hung-Chin Tsai, Phenix-Lan Quan, and W. Ian Lipkin
Author affiliations: Columbia University, New York, New York, USA (C.-C. Hsu, R. Tokarz, T. Briese, P.-L. Quan, W.I. Lipkin); Southern Taiwan University of Science and Technology, Tainan, Taiwan (C.-C. Hsu); Chi-Mei Medical Center, Tainan (C.-C. Hsu); National Yang-Ming University Kaohsiung, Taiwan (H.-C. Tsai); Kaohsiung Veterans General Hospital, Kaohsiung (H.-C. Tsai)

Main Article

Table 1

Primers for MassTag central nervous system infections panel, RNA pathogens

Pathogen Target gene Primer sequence, 5′↔3′* Mass code
Eastern equine encephalitis virus E1 Fwd: ACACTAAATTCACCCTAGTTCGAT
Rev: GTGTATAAAATTACTTAGGAGCAGCATTATG 383/650
Nipah/Hendra virus Phos Fwd: GGGGGAATGYCTAAGRATGATG
Rev: TCCGGTACATTCTCCTCCATG 519/566
Japanese encephalitis virus NS5 Fwd: TCAACCTAGGGAGCGGAACA
Rev: GGCTGAGCCAGTAGCCTTCA 582/698
Parechovirus 5UTR Fwd: ACACTAGTTGTAAGGCCCACGAA
Rev: GGTBTGGCCCACTAGACGTTTT 690/606
Powassan virus NS5 Fwd: CATCCGACCATGCACCTAGA
Rev: CCAAAGTGAGGATGTGTACCAAAG 622/375
La Crosse virus S Fwd: CTCAACCTTGCTGCAGTTAGGA
Rev: CCACCTGCCACTCTCCAAA 686/590
Lymphocytic choriomeningitis virus pol Fwd: CCACTYTTGTCTGCACTGTCTAT
Rev: CTTTTTGATGCGCAATGGAT
614/654
St. Louis encephalitis virus NS5 Fwd: CATTTGTTCAGCTGTCCCAGTC
Rev: CTCACCCTTCCCATGAATTGA 658/423
Enteroviruses 5UTR Fwd: TCCTCCGGCCCCTGAATGCGGCTAATCC
Rev: GAAACACGGWCACCAAAGTASTCG 495/702
West Nile virus DF3 Fwd: CCACCGGAAGTTGAGTAGACG
Rev: GCTTTGTTCACCCAGTCCTCCT 499/539
Western equine encephalitis virus E1 Fwd: ACATCGAGCCCACAAGCA
Rev: GCATAGAGCTGCAGACCAACAC 598/678
Venezuelan equine encephalitis virus E1 Fwd: CTACGCGCCACTCCCTATCA
Rev: TGGCAGGTGACGTACTCCAA 602/646
Rabies virus N Fwd: GGGTTYATAAAVCAGATWAATCTCAC
Rev: GAAGTGRATGAAATARGAGTGAGG 475/558
Influenza A virus M Fwd: CATGGAATGGCTAAAGACAAGACC
Rev: AAGTGCACCAGCAGAATAACTGAG 618/690

*Fwd, forward primer; Rev, reverse primer.

Main Article

TOP