Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 19, Number 9—September 2013

Research

Use of Staged Molecular Analysis to Determine Causes of Unexplained Central Nervous System Infections

Chien-Chin HsuComments to Author , Rafal Tokarz, Thomas Briese, Hung-Chin Tsai, Phenix-Lan Quan, and W. Ian Lipkin
Author affiliations: Columbia University, New York, New York, USA (C.-C. Hsu, R. Tokarz, T. Briese, P.-L. Quan, W.I. Lipkin); Southern Taiwan University of Science and Technology, Tainan, Taiwan (C.-C. Hsu); Chi-Mei Medical Center, Tainan (C.-C. Hsu); National Yang-Ming University Kaohsiung, Taiwan (H.-C. Tsai); Kaohsiung Veterans General Hospital, Kaohsiung (H.-C. Tsai)

Main Article

Table 2

Primers for MassTag CNS infections panel: DNA pathogens

Pathogen Target gene Primer sequence, 5′→3* Mass code
Virus
Adenoviruses Hexon Fwd: CCCMTTYAACCACCACCG
Rev: ACATCCTTBCKGAAGTTCCA 503/630
Cytomegalovirus Pol Fwd: CATGCGCGAGTGTCAAGAC
Rev: ACTTTGAGYGCCATCTGTTCCT 610/626
Epstein-Barr virus EBER Fwd: AAACCTCAGGACCTACGCTGC
Rev: AGACACCGTCCTCACCAC 570/463
Varicella-zoster virus Gp 31 Fwd: CCGATTCTGGATTTTCGTTGTT
Rev: AAAGTCGATTTCCCCCCAAA 471/515
Human herpesvirus 6 U7 Fwd: AAAATTTCTCACGCCGGTATTC
Rev: CCTGCAGACCGTTCGTCAA 357/718
Human herpesvirus 1 Gp C1 Fwd: GATGCCGGTTTCGGAATTC
Rev: CCCATGGAGTAACGCCATATCT 706/666
Human herpesvirus 2 UL3 Fwd: GGTCCCCTCTGCGTTTACTA


Rev: TCGACTCTATGGGCGTCGTA
527/642
Bacterium
Haemophilus influenzae hgbC Fwd: CGCTGGAAAGAGAACAAGCAA
Rev: TTTCAGCTTGACGTAATCCATC 726/734
Streptococcus pneumoniae plysin Fwd: GACTCCTAAGGCTTGGGACAGAAAT
Rev: TTCATAAACCGTACGCCACCATTC 694/714
Neisseria meningitides ctrA Fwd: TTCTGATGCGCGTGGTGTGT
Rev: CGCATCAGCCATATTCACACGA 439/730
Leptospira interrogans flaB Fwd: GATCATGAAGCAGAGRGCGGATATG
Rev: CCATATCGGCGTCYCGAATTC 634/383
Mycobacterium tuberculosis pncA Fwd: ACGTCAGGCCCACGACATTGA


Rev: CCTGGGCAAGCTGAACCTCGAA
395/475
Parasite: Toxoplasma gondii B1 Fwd: GAAGAGATCCAGCAGATCTCGT


Rev: TGAGAGGAGGCAGCACAAG
548/562
Fungus
Candida albicans CaAG Fwd: ACCAGTAGGAGTACAACGAACAGGAA
Rev: ATTTCATTGAATATTGGTGTGGTTCA 602/670
Cryptococcus neoformans cap59 Fwd: GCGAGGCAGCACAAGTACTT
Rev: TTGTCTGGTCGTTGGAMCCGTT 650/638

*Fwd, forward primer; Rev, reverse primer.

Main Article

TOP