Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 20, Number 4—April 2014

Research

Active Surveillance for Avian Influenza Virus, Egypt, 2010–2012

Ghazi KayaliComments to Author , Ahmed Kandeil, Rabeh El-Shesheny, Ahmed S. Kayed, Mokhtar M. Gomaa, Asmaa M. Maatouq, Mahmoud M. Shehata, Yassmin Moatasim, Ola Bagato, Zhipeng Cai, Adam Rubrum, Mohamed A. Kutkat, Pamela P. McKenzie, Robert G. Webster, Richard J. Webby, and Mohamed A. Ali
Author affiliations: St. Jude Children's Research Hospital, Memphis, Tennessee, USA (G. Kayali, A. Rubrum, P.P. McKenzie, R.G. Webster, R.J. Webby); National Research Center, Giza, Egypt (A. Kandeil, R. El-Shesheny, A.S. Kayed, M.M. Gomaa, A.M. Maatouq, M.M. Shehata, Y. Moatasim, O. Bagato, M.A. Kutkat, M.A. Ali); Georgia State University, Atlanta, Georgia, USA (Z. Cai)

Main Article

Table 1

Primers used for H5 and H9 subtyping of avian influenza viruses from Egypt, 2010–2012*

Primer Sequence, 5′→3′ Reference
M30F2/08 ATGAGYCTTYTAACCGAGGTCGAAACG (12)
M264R3/08 TGGACAAANCGTCTACGCTGCAG
H5–155f ACACATGCYCARGACATACT (13)
H5–699r CTYTGRTTYAGTGTTGATGT
H9–151f CTYCACACAGARCACAATGG
H9–638r GTCACACTTGTTGTTGTRTC
BDH9–4F2 CAAGCGTGACAACAGAAAATTTGG Designed in-house†
BDH9–2R2 CTCCTGAGAGAACGTGTCCATACC
H9PROB FAM CTTACTCGCAATGTCTGGCCTGGTTTTAG BHQ1
AH5b_Forward GGA ATGYCCCAAATATGTGAAATCAA (14)
AH5b_R CCACTCCCCTGCTCRTTGCT
H5PROB FAM TACCCATACCAACCATCTACCATTCCC BHQ1
Inf-A F ACCRATCCTGTCACCTCTGAC
Inf-A R AGGGCATTYTGGACAAAKCGTCTA
Inf-A POB FAM TGCAGTCCTCGCTCACTGGGCACG BHQ1

*Typing by reverse transcription PCR and quantitative reverse transcription PCR.
†St. Jude Children’s Research Hospital, Memphis, TN, USA.

Main Article

TOP