Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 20, Number 4—April 2014

Research

High Rates of Antimicrobial Drug Resistance Gene Acquisition after International Travel, the Netherlands

Christian J.H. von Wintersdorff, John Penders, Ellen E. Stobberingh, Astrid M.L. Oude Lashof, Christian J.P.A. Hoebe, Paul H.M. Savelkoul, and Petra F.G. WolffsComments to Author 
Author affiliations: Maastricht University Medical Center, Maastricht, the Netherlands (C.J.H. von Wintersdorff, J. Penders, E.E. Stobberingh, A.M.L. Oude Lashof, C.J.P.A. Hoebe, P. Savelkoul, P.H.M. Wolffs); South Limburg Public Health Service, Geleen, the Netherlands (C.J.P.A. Hoebe)

Main Article

Table 1

PCR primer/probe sequences and additional PCR conditions to identify antimicrobial resistance genes in gut microbiota after international travel, the Netherlands, 2010–2012

Primer/probe Sequence,* 5′→3′ Final conc., nM Amplicon size, bp Cycling conditions Ref.
16S-rDNA_F TGGAGAGTTTGATCCTGGCTCAG 500 526 95°C, 4 min (18)
16S-rDNA_R
TACCGCGGCTGCTGGCAC
250

35 × 95°C, 15 s; 65°C, 60 s

cfxA_F TGACAGTGAGAGATTTGCTGC 300 150 95°C, 3 min (19)
cfxA_R
GGTCAGCCGACATTTCCTCTT
300

40 × 95°C, 15s; 60°C, 15s; 72°C, 30s

tetM_F ACACGCCAGGACATATGGAT 300 126 95°C, 3 min (19)
tetM_R
GGGAATCCCCATTTTCCTAA
300

40 × 95°C, 15s; 57°C, 15s; 72°C, 30s

tetQ_F CAAGGTGATATCCGCTCTGA 300 128 95°C, 3 min (19)
tetQ_R
GGAAAATCGTTCTTCCAGCA
300

40 × 95°C, 15s; 57°C, 15s; 72°C, 30s

ermB_F AAGGGCATTTAACGACGAAACTG 300 438 95°C, 3 min This study
ermB_R
ATTTATCTGGAACATCTGTGGTATG
300

40 × 95°C, 20s; 60°C, 30s; 72°C, 40s
aac6-aph2_F TTGGGAAGATGAAGTTTTTAGA 300 173 95°C, 3 min (20)
aac6-aph2_R
CCTTTACTCCAATAATTTGGCT
300

40 × 95°C, 15s; 57°C, 20s; 72°C, 30s

CTX-M_F ATGTGCAGYACCAGTAARGTKATGGC 500 336 95°C, 15 min (21)
CTX-M_R ATCACKCGGRTCGCCNGGRAT 500 40 × 95°C, 15s; 58°C, 20s
CTX-M-1 JOE-CCCGACAGCTGGGAGACGAAACGT-BHQ1 100 72°C, 30s
CTX-M-2 6FAM-CAGGTGCTTATCGCTCTCGCTCTGTT-BHQ1 100
CTX-M-9 JOE-CTGGATCGCACTGAACCTACGCTGA-BHQ1 100
CTX-M-2-8-9-25
6FAM-CGACAATACYGCCATGAA-MGB-NFQ
100



NDM_F ATTAGCCGCTGCATTGAT 400 154 95°C, 15 min (22)
NDM_R CATGTCGAGATAGGAAGTG 400 42 × 95°C, 15s; 60°C, 60s
NDM_probe
6FAM- CTG[+C]CA[+G]AC[+A]TT[+C]GGTGC-BHQ1
200



qnrA_F CAGTTTCGAGGATTGCAGTT 400 148 95°C, 15 min (23)
qnrA_R CCTGAACTCTATGCCAAAGC 400 45 × 95°C, 30s; 52°C, 30s;
qnrA_probe
6FAM-AAGGGTGYCACTTCAGCTATGCC-BHQ1
100

72°C, 30s

qnrB_F CAGATTTYCGCGGCGCAAG 400 134 95°C, 15 min (23)
qnrB_R TTCCCACAGCTCRCAYTTTTC 400 45 × 95°C, 30s; 55°C, 30s;
qnrB_probe
6FAM-CGCACCTGGTTTTGYAGYGCMTATATCAC-BHQ1
100

72°C, 30s

qnrS_F TCAAGTGAGTAATCGTATGTA 400 157 95°C, 15 min (23)
qnrS_R GTCTGACTCTTTCAGTGAT 400 45 × 95°C, 30s; 55°C, 30s
qnrS_probe 6FAM-CCAGCGATTTTCAAACAACTCAC-BHQ1 100 72°C, 30s

*Nucleic acids between brackets and preceded by + are locked nucleic acids; nM, nanomolar; conc., concentration; ref., reference.

Main Article

*These authors contributed equally to this article and are co–first authors.

TOP