Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 20, Number 4—April 2014

Dispatch

Complete Genome of Hepatitis E Virus from Laboratory Ferrets

Tian-Cheng LiComments to Author , Tingting Yang, Yasushi Ami, Yuriko Suzaki, Masayuki Shirakura, Noriko Kishida, Hideki Asanuma, Naokazu Takeda, and Wakita Takaji
Author affiliations: National Institute of Infectious Diseases, Tokyo, Japan (T.-C. Li, Y. Ami, Y, Suzaki, M. Shirakura, N. Kishida, H. Asanuma, W. Takaji); Affiliated Hospital of Qingdao University Medical College, Qingdao, China (T. Yang); Osaka University, Osaka, Japan (N. Takeda)

Main Article

Table 1

Oligonucleotides used to amplify ferret hepatitis E viruses

Primer (nucleotide positions)* Sequence, 5′→3′ Product length, bp†
Forward FF1 (1–21) GGCAGACCCCTAATGGAGACA
Reverse FR628 (628–648) GTTGCGTGCGACATAGGCCTT 626
Forward FF541 (541–561) AGCAATGTATCGCCATGGCAT
Reverse FR1535 (1535–1554) ATCTGCATCAGTCGGGCACA 1,014
Forward FF1518 (1518–1538) AGGATCTGACAGTAGACCTGT
Reverse FR2555 (2555–2577) TGCAATGCCAAATTAGCTGTGT 1,060
Forward FF2401 (2401–2421) GGCGATGAGTTGTACCTGTTA
Reverse FR3424 (3432–3445) GAGCAGCCGGTAACATACTCAA 1,045
Forward FF3336 (3336–3355) GCACAATTTCTATCTCACCA
Reverse FR4210 (4210–4230) ACTCCGAATCAGATGATACA 985
Forward FF4181 (4181–4202) GGCTGGTGCACCTGAATGGCT
Reverse FR5800 (5800–5821) TCAGGCAGACGGCGTATCTTAT 1,641
Forward FF4812 (4812–4831) ATGGAGCATGTGTACAAGAT
Reverse TX30SXN GACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT ≈2,050
Reverse FR451‡ ACACCGTGTGAATCCCTCCGT
Abridged amplification GGCCACGCGTCGACTAGTACGGGIIGGGIIGGGIIG
Reverse FR279 (279–300) ATAGATCTAGGATGCGCACCAA §
Abridged universal amplification GGCCACGCGTCGACTAGTAC
Reverse FR191 (191–211) CGGATGCGACCAAACAACAGA ≈240

*Values in parentheses indicate positions of the primer corresponding to the entire genome of hepatitis E virus (JN998607) isolated from ferret.
†Blank cell indicates that 1 primer pair produced 1 product.
‡Used only for cDNA synthesis.
§PCR product was not detected.

Main Article

TOP