Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 20, Number 5—May 2014

Research

Molecular Characterization of Cryptically Circulating Rabies Virus from Ferret Badgers, Taiwan

Hue-Ying Chiou, Chia-Hung Hsieh, Chian-Ren Jeng, Fang-Tse Chan, Hurng-Yi Wang, and Victor Fei PangComments to Author 
Author affiliations: National Taiwan University, Taipei, Taiwan, Republic of China (H.-Y. Chiou, C.-H. Hsieh, C.-R. Jeng, H.-Y. Wang, V.F. Pang); Council of Agriculture, Executive Yuan, Nantou County, Taiwan, Republic of China (F.-T. Chan)

Main Article

Table 1

Primers used for the amplification and sequencing of rabies virus genome*

Primer Sequence, 5′→3′ Amplicon size, nt Position, nt
3′F GTACCTAGACGCTTAACAAC 499 1–499
3′R AAGACCGACTAAGGACGCAT
NF ATGTAACACCTCTACAATGG 1,533 55–1587
NR CAGTCTCYTCNGCCATCT
PF GAACCAYCCCAAAYATGAG 1,001 1500–2500
PR TTCATTTTRTYAGTGGTGTTGC
MF AAAAACRGGCAACACCACT 641 2479–3119
MR TCCTCYAGAGGTAWACAAGTG
G1F TGGTGTATAACATGRAYTC 1,097 3000–4096
G1R ACCCATGTYCCRTCATAAG
G2F TGGATTTGTGGATKAAAGAGGC 1,542 3995–5536
G2R GAGTTNAGRTTGTARTCAGAG
L1F TGGRGAGGTYTATGATGACCC 726 5430–6155
L1R CAGCATNAGTGTRTAGTTTCTGTC
L2F GGTCGATTATGATAAKGCATTTGG 704 5885–6588
L2R TTGACAGACCCTTTCGATAATC
L3F GGATCAATTCGACAACATACATG 550 6473–7024
L3R AAGTCTTCATCHGGCARTCCTCC
L4F AGACTAGCTTCHTGGYTGTCAG 708 6882–7589
L4R TACTTTGGTTCTTGTGTTCCTG
L5F AGTGTTTGGATTGAAGAGAGTGTT 662 7337–7998
L5R GAAAGACTGCCTGCACTGACAT
L6F AATAGTCAACCTCGCCAATATAATG 767 7897–8645
L6R GGATCTCTGAGTTGTAGAAGGATTC
L7F CCGAGTCAATCATTGGATTGATAC 621 8517–9137
L7R GAATACCCTCCTTCGCTGTATCTG
L8F GAGAAGGTCACCAATGTTGATG 1,045 8958–10002
L8R AGATCCAYARCCAGTCATTCTC
L9F ACATAATGCTCAGAGAACCGT 503 9820–10322
L9R CCATTCTGAACATCCTACCTT
L10F TGTTCAGAATGGGTCTGCTCT 509 10302–10811
L10R TGCATCGCAAATAATGAGGT
L11F ATTATTTGCGATGCAGAAGT 524 10797–11320
L11R ATGATAGCCACTTTAGACAGAGT
L12F GTTACAGAGGGGAACTCTGTCT 386 11285–11670
L12R TCTTCACTATCTTGTAAATCAACCT
5′F TGGATCAGGTTGATTTACAAGATAGT 293 11640–11932
5′R ACGCTTAACAAATAAACAACAAAAAT

*Primers were from Lei et al. (10).

Main Article

1Joint senior authors who contributed equally to this article.

TOP