Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 20, Number 5—May 2014

Dispatch

Francisella tularensis subsp. tularensis Group A.I, United States

Dawn N. Birdsell, Anders Johansson, Caroline Öhrman, Emily Kaufman, Claudia Molins, Talima Pearson, Miklós Gyuranecz, Amber Naumann, Amy J. Vogler, Kerstin Myrtennäs, Pär Larsson, Mats Forsman, Andreas Sjödin, John D. Gillece, James Schupp, Jeannine M. Petersen, Paul Keim, and David M. WagnerComments to Author 
Author affiliations: Northern Arizona University, Flagstaff, Arizona, USA (D.N. Birdsell, E. Kaufman, T. Pearson, A. Naumann, A.J. Vogler, P. Keim, D.M. Wagner); Umeå University, Umeå, Sweden (A. Johansson); Swedish Defense Research Agency, Umeå (C. Öhrman, K. Myrtennäs, P. Larsson, M. Forsman, A. Sjödin); Centers for Disease Control and Prevention, Fort Collins, Colorado, USA (C. Molins, J.M. Petersen); Center for Agricultural Research, Hungarian Academy of Sciences, Budapest, Hungary (M. Gyuranecz); Translational Genomics Research Institute, Flagstaff (J. Gillece, J. Schupp, P. Keim)

Main Article

Table 2

Melt-MAMA primers targeting canSNPs for new phylogenetic branches in Francisella tularensis subsptularensis A.I in United States*

SchuS4† position SNP state, der/anc‡ Primers, 5′ → 3′§ Con¶ Temp, °C#
Subgroup
Major Minor
NA A.I.7 1005448** C/T A: TATTTCAATTTTTGCGATGGTAgGT 0.80 55
D: ggggcggggcggggcTATTTCAATTTTTGCGATGGTAcTC 0.20
C: AAGTATGTTGGCAAGTAAAGTGAGAAGA 0.20
A.I.12 NA 142781†† C/G A: GCTTATCGCCGACATTCATCtAC 0.20 60
D: ggggcggggcggggcgggCTTATCGCCGACATTCATCcAG 0.20
C: GGTATGGCAAAAAATACTTATGGTACG 0.20
A.I.12 A.I.13 1833651‡‡ T/C A: CTTTCAATCATGTAACCATCATTATTTAaGC 0.80 60
D: cggggcggggcggggcggggCTTTCAATCATGTAACCATCATTATTTAgGT 0.20
C: CTTAATGAACTTGGTGTAATGGGTAGATA 0.20
A.I.12 A.I.16 273622 T/C A: AAACTTAAAAAAGAGCAAGAACTTAATGATcTC 0.60 60
D: ggggcggggcggggcgAAACTTAAAAAAGAGCAAGAACTTAATGATaTT 0.15
C: CATCTTCATTAAAAGTCTTATTGTTTAAACGC 0.15
A.I.12 A.I.15 1210286 A/G A: TCTTAAAACATCGACACTCTCAACcTG 0.80 60
D: ggggcggggcggggcGATCTTAAAACATCGACACTCTCAACtTA 0.20
C: gtatcattcagatcataatgaagcaactatc 0.20
A.I.12 A.I.14 1296147 T/C A: ATCATACTGGTTATATTGGCGGTcTC 0.80 60
D: cggggcggggcggggcggggATCATACTGGTTATATTGGCGGTgTT 0.20
C: GATGAGTCGCTATTAGCTTCTCGAAAG 0.20
A.I.8 NA 1150298 G/A A: TAGTCAATCTTGGAACTCCAGAtAA 0.75 60
D: ggggcggggcggggcTAGTCAATCTTGGAACTCCAGAaAG 0.15
C: TCTATTACTCTAGGGTCAGATAGAAATTC 0.15
A.I.8 A.I.9 1453599 C/T A: GCTGCTGCTAGATTAGCTATgCT 0.15 60
D: ggggcggggcggggcGCTGCTGCTAGATTAGCTATcCC 0.15
C: TCAAGCAATCAACAATAATTTTACTAT 0.15
A.I.8 A.I.10 797599 T/G A: GATCAATTGGTGGTGTTcCG 0.80 60
D: ggggcggggcggggcGTGATCAATTGGTGGTGTTtCT 0.20
C: AACGTTTTATCCTCTTGAATATCAACTAT 0.20
A.I.8 A.I.11 1278606 G/A A: AAGGAACAAAAAACATCATCATTgCT 0.20 60
D: ggggcggggcggggcAAAAGGAACAAAAAACATCATCATTaCC 0.20
C: TCATACTAACAACGGCTATTCAGGGA 0.20
A.I.3 NA 1233898 T/G A: GCTTGACAATATTAGCTTATAAAACTATAgTG 0.15 60
D: ggggcggggcggggcGCTTGACAATATTAGCTTATAAAACTATAaTT 0.15
C: TTTTTTCCATATTTCTGTAAAAAATATACTATTATG 0.15
A.I.3 A.I.4 830715§§ T/C A: GTTAAGTCGGTAAGTATCGACAAaTC 0.60 60
D: ggggcggggcggggcGTTAAGTCGGTAAGTATCGACAAgTT 0.20
C: CAAATCTTCTAGTATCTCTTTATCTTCAG 0.20
A.I.3 A.I.5 113671 G/A A: cgggcgggcgggcgggGCTTGAGTTTATTTTTTGTTTAATGTgTA 0.20 60
D: GCTTGAGTTTATTTTTTGTTTAATGTaTG 0.20
C: GGACAAAACTGTGGACGTTAAGAA 0.20
A.I.3 A.I.6 580153 G/A A: cgggcgggcgggcgggTATAATGGTAACTCATGATCAAGAAcAA 0.20 60
D: TTATAATGGTAACTCATGATCAAGAAaAG 0.20
C: ATCTGTCATGATACCAATTCTTGTCG 0.20

*Melt-MAMA, melt–mismatch amplification mutation assay; SNP, single nucleotide polymporphism; canSNP, canonical SNP; con, concentration, μmol/L; temp, annealing temperature, °C; NA, not applicable; der, derived SNP state; anc, ancestral SNP state; D, derived allele primer; A, ancestral allele primer; C, common primer.
†Genomic position in reference A.I SchuS4 strain (GenBank accession no. NC_006570).
‡SNP states are listed according to their orientation in the SCHU S4 reference genome (GenBank accession no. AJ749949.2).
§Melt-MAMA primer sequences; primer tails and antepenultimate mismatch bases are in lower case.
¶Final concentration of each primer in Melt-MAMA genotyping assays.
#Assay annealing temperature.
**Assay designed on the reverse complement.
††SNP from (6).
‡‡Assay supplemented with 0.025 U of Platinum Taq DNA polymerase (Life Technologies, Invitrogen, Frederick, MD, USA).
§§SNP from (7).

Main Article

TOP