Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 4, Number 2—June 1998

Dispatch

Dual Infection with Ehrlichia chaffeensis and a Spotted Fever Group Rickettsia: A Case Report

Daniel J. Sexton*Comments to Author , G. Ralph Corey*, Christopher Carpenter*, Li Quo Kong*, Tejel Gandhi*, Edward B. Breitschwerdt†, Barbara C. Hegarty†, Sheng-Ming Chen‡, Hui-Min Feng‡, Li Zhao‡, Juan Olano‡, David H. Walker‡, and Stephen J. Dumler§
Author affiliations: *Duke University Medical Center, Durham, North Carolina, USA; †North Carolina State University, Raleigh, North Carolina, USA; ‡University of Texas Medical Branch at Galveston, Galveston, Texas, USA; §Johns Hopkins Medical Center, Baltimore, Maryland, USA

Main Article

Table 2

Sequences of primers used in amplification of the NadA gene and the 120 kDa protein gene of Ehrlichia chaffeensis

Gene Primers Sequence
NadA gene ECHNADA1 5' TCATTTCGTGCTTTCTTATTG 3'
pXCR6 5' TGCCCACATATGCGTTTG 3'
120 kDa protein gene pXCF3 5' CAGAATTGATTGTGGAGTTGG 3'
pXAR4 5' ACATAACATTCCACTTTCAAA 3'
120 kDa protein gene nested pXCF3b 5' CAGCAACAGCAAGAAGATGAC 3'
pXAR5 5' ATCTTTCTCTACAACAACCGG 3'

Main Article

TOP