Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 5, Number 1—February 1999

Research

Genetic Diversity and Distribution of Peromyscus-Borne Hantaviruses in North America

Martha C. Monroe*, Sergey P. Morzunov†, Angela M. Johnson*, Michael D. Bowen*, Harvey Artsob‡, Terry Yates§, C.J. Peters*, Pierre E. Rollin*, Thomas G. Ksiazek*, and Stuart T. Nichol*Comments to Author 
Author affiliations: *Centers for Disease Control and Prevention, Atlanta, Georgia, USA;; †University of Nevada, Reno, Nevada, USA;; ‡Laboratory Centre for Disease Control, Federal Laboratories, Winnipeg, Manitoba, Canada;; §University of New Mexico, Albuquerque, New Mexico, USA

Main Article

Table 2

PCR and sequencing primers

1st-round primers (5' to 3') 2nd-round primers (5' to 3') Basis of primer design (ref.) Amplicon size
TTTAAGCAATGGTG(C/T)ACTAC(T/A)AC AGAAAGAAATGTGCATTTGC Puumala/ Prospect Hill/ 278
CCATAACACAT(A/T)GCAGC CCTGAACCCCATGC(A/T/C)CCATC Arvicolinae (2)
TTTAAGCAATGGTG(C/T)ACTAC(T/A)AC AAGGTAACACAGT(G/C)TCTGGATTC Sin Nombre/ Western 185
CCATAACACAT(A/T)GCAGC GGTTATCACTTAGATC(C/T)TGAAAGG U.S. 1st generation (2)
AGAAAGATCTGTGGGTTTGC AAGGTAACACAGT(G/C)TCTGGATTC Sin Nombre/ Western 185
CCTGAACCCCAGGCCCCGT GGTTATCACTTAGATC(C/T)TGAAAGG U.S. 2nd generation (11)
TGTGTGTTTGGAGACCCTGG ATGTCAACAAC(A/G)AGTGGGATG Sin Nombre Nevada/ 185
TC(A/G)ATAGATTGTGTATGCA CATGGGTTATCACTTAG(G/A)TC E. California (31)
CAGAAAGATCTGCGGGTTTGC CAAGGGAATACTGTCTCTGGATTT Bayou virus/LA/ 185
CCCGAGCCCCATGCACCAT GATTGTCACTCAGATCTTGAAATG East Coast/ S. American (19,20)
TGTGAITATCAAGGIAAIAC TGTGAITATCAAGGIAAIAC General Sigmodontinae 242
ACIG(A/T)IGCICCATAICACAT CCCCAIGCICCITCAAT (10)

Main Article

TOP