Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 6, Number 3—June 2000

Research

Rhinosporidium seeberi: A Human Pathogen from a Novel Group of Aquatic Protistan Parasites

David N. Fredricks*†Comments to Author , Jennifer A. Jolley*, Paul W. Lepp*, Jon C. Kosek†, and David A. Relman*†
Author affiliations: *Stanford University, Stanford, California, USA; and †Veterans Affairs, Palo Alto Health Care System, Palo Alto, California, USA

Main Article

Table

Polymerase chain reaction primers, sequencing primers, and fluorescence in situ hybridization probes

Primer/Probe Nucleotide sequence (5'->3') SSU rRNA Positiona
F1-fwb CAAGTCTGGTGCCAGCAGCC 554-573
F2-revc GATTTCTCGTAAGGTGCCGA 1068-1087
F3-rev AATGCTCTATCCCCAMCACG 1531-1550
Dermo-fw CTGCCAGTAGTCATATGCTTG
Dermo-rev GATCAAGTTTGATCAACTTTTCGGCA
Rhino-fw GGCGTGTGCGCTTAACTGTC
Rhino-rev TGCTGATAGAGTCATTGAAT
Rhino FISH probe BTGCTGATAGAGTCATTGAATTAACATCTACB
Control FISH probe BACGACTATCTCAGTAACTTAATTGTAGATGB

Main Article

TOP