Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 7, Number 1—February 2001

Synopsis

Geographic Subdivision of the Range of the Malaria Parasite, Plasmodium vivax

Jun Li*, William E. Collins†, Robert A. Wirtz†, Dharmendar Rathore*, Altaf Lal†, and Thomas F. McCutchan*Comments to Author 
Author affiliations: *National Institutes of Health, Bethesda, Maryland, USA; †Centers for Disease Control and Prevention, Atlanta, Georgia, USA

Main Article

Figure 4

Polymorphism in the ORF 470 region of the 35-kb plastid-like DNA was determined by DNA sequence analysis after amplification of DNA from each isolate with oligonucleotide primers #1274 (5'GTAAAATTATATAAACCACC3') and #1273 (5'GCACAATTTGAACGTAC3') (11).

Figure 4. Polymorphism in the ORF 470 region of the 35-kb plastid-like DNA was determined by DNA sequence analysis after amplification of DNA from each isolate with oligonucleotide primers #1274 (5'GTAAAATTATATAAACCACC3') and #1273 (5'GCACAATTTGAACGTAC3') (11).

Main Article

¹The biologic diversity inherent in P. vivax already justifies the use of a trinomial system for naming its members that includes the designation of subspecies, a taxonomic character given formal recognition in the International Rules of Zoological Nomenclature. A subspecies is a population or group of populations inhabiting a geographic subdivision of the range of a species and differing from other populations by diagnostic morphologic characteristics.

²The designation of separate species does not require that the two organisms cannot mate and produce viable progeny, only that this does not happen with frequency in natural situations.

TOP