Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 8, Number 12—December 2002

Research

First Isolation of West Nile virus from a Patient with Encephalitis in the United States

Cinnia Huang*Comments to Author , Brett Slater*, Robert Rudd*, Nandakishore Parchuri†, Rene Hull*, Michelle Dupuis*, and Alexander Hindenburg†
Author affiliations: *Wadsworth Center, New York State Department of Health, Albany, New York, USA; †Winthrop University Hospital, Mineola, New York, USA;

Main Article

Table 1

Oligonucleotide primers and probe used in the standard RT-PCR and TaqMan assaysa

Primer Genome target Genome positionb Sequence (5′–3′) RT-PCR product size (bp)
CU9093 NS5 9097–9120 AGYMGRGCHATHTGGTWYATGTGG 206
CL9279 NS5 9302–9283 TTCCAVCCDGCKGTRTCATC
D87F NS5 10034–10051 GCTCCGCTGTCCCTGTGA 70
D156R NS5 10103–10083 CACTCTCCTCCTGCATGGATG
Forwardddd ENV 1160–1180 TCAGCGATCTCTCCACCAAAG 70
Reverse ENV 1229–1209 GGGTCAGCACGTTTGTCATTG
Probe ENV 1186–1207 TGCCCGACCATGGGAGAAGCTC

aRT-PCR, reverse transcription–polymerase chain reaction.
bGenome position according to GenBank accession no. AF196835.

Main Article

TOP